Prev. |  KEGG KO K06267 > 

RIKEN DNA Bank Human Resource - HMMR

Gene ID NCBI Gene 3161 |  KEGG hsa:3161
Gene Symbol HMMR
Protein Name hyaluronan mediated motility receptor
Synonyms CD168|IHABP|RHAMM
Ortholog resource in our bank

  HMMR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016910 IRAK042E14 pCMV-SPORT6 BC033568 NM_012485 Partial/var
HGX025609 IRAK064A09 pCMV-SPORT6 BC030505 NM_012484 Partial/var
HGY099453 IRAL048K13 pDNR-LIB BC057235 NM_012485 Partial/var
HGY102821 IRAL057A21 pDNR-LIB BC070281 NM_012485 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348528 RBb71F08 pGCAP1 NM_012484.1  
GGAGGAGTGCCAGTCACCTTCAGTTTCTGGAGCTGGCCGTCAACATGTCCTTTCCTAAGG
HKR370836 RBd27B12 pGCAP10 NM_012484.1  
GGCCAGTCACCTTCAGTTTCTGGAGCTGGCCGTCAACATGTCCTTTCCTAAGGCGCCCTT
HKR386407 RBd66A07 pGCAP10 NM_012484.1  
GACCTTCAGTTTCTGGAGCTGGCCGTCAACATGTCCTTTCCTAAGGCGCCCTTGAAACGA
HKR471058 RBdS177K18 pGCAP10 NM_012484.1  
GGGGNTGGCAGNGNGGCCNGTNCCCNNNNNANANGGGAGNNNNNGNNCANANAGNCCTTN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl