Prev. |  KEGG KO K09282 > 

RIKEN DNA Bank Human Resource - HMGA1

Gene ID NCBI Gene 3159 |  KEGG hsa:3159
Gene Symbol HMGA1
Protein Name high mobility group AT-hook 1
Synonyms HMG-R|HMGA1A|HMGIY
Ortholog resources KEGG ortholog (KEGG orthology K09282) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04700 pAxCALNLhHMGIY(forward) Shuttle vector to generate rAd expressing human HMGA1
RDB04733 pAxCALNLhHMGIY(reverse) Shuttle vector to generate rAd expressing human HMGA1
RDB05012 pAxCALNLhHMGIY(forward) Shuttle vector to generate rAd expressing human HMGA1
RDB05013 pAxCALNLhHMGIY(reverse) Shuttle vector to generate rAd expressing human HMGA1
RDB05142 pAxCALNLhHMGIY (forward) Shuttle vector to generate rAd harboring human HMGIY (forward)

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084494 IRAL011D22 pOTB7 BC004924 NM_145905 Full
HGY087170 IRAL017P10 pOTB7 BC008832 NM_145904 Full
HGY093837 IRAL034J21 pOTB7 BC015789 NM_145905 Full
HGY100057 IRAL050C09 pOTB7 BC067083 NM_145904 Full
HGY103284 IRAL058D12 pOTB7 BC071863 NM_145905 Partial
HGY103400 IRAL058I08 pOTB7 BC071864 NM_145904 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046052 ARe15C04 pKA1U5 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR049772 ARe24H04 pKA1U5 NM_002131.3  
GGCCCCTGGGTCGCTCTTTTTAAGCTCCCCTGCCNTNAAGNGTGCGCTCCTCTAANTGGG
HKR060826 ARe52B02 pKA1U5 NM_002131.3  
ATCCTGGCCTCTAATTGGGACTCCGAGCCGGGCCTATTTCTGGCGCTGGCGCGNCTCCAA
HKR162502 ARi06E06 pGCAP10 NM_002131.3  
CGGCCGGCCGATGCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGG
HKR166453 ARi16C05 pGCAP10 NM_002131.3  
GCTTTTTAAGCTCCCCTGAGCCGGTGCTGCGCTCCTCTAATTGGGACTCCGAGCCGGGGC
HKR172857 ARi32C09 pGCAP10 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR175729 ARi39F09 pGCAP10 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR183682 ARi59D10 pGCAP10 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCNAGANGCAT
HKR186974 ARi67H06 pGCAP10 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR203253 ARiS008C05 pGCAP10 NM_002131.3  
CGGCCGGCCGATGCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGG
HKR218122 ARiS045F02 pGCAP10 NM_002131.3  
GCCTCTANTTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR219974 ARiS049P14 pGCAP10 NM_002131.3  
ATGNNCNNCGCGGCGGCGGCGGTCTCTGAGCGCCTCTGCTCTCTCTCCCGGTTTCAGATC
HKR243879 ARiS109L15 pGCAP10 NM_002131.3  
GCTTTTTAAGCTCCCCTGAGCCGGTGCTGCGCTCCTCTAATTGGGACTCCGAGCCGGGGC
HKR260003 ARiS150A03 pGCAP10 NM_002131.3  
GCTTTTTTAANCTCCCCTGAGCCGGTGCTGCGCTCCTCTAATTGGGACTCCGAGCCGGGG
HKR260181 ARiS150H13 pGCAP10 NM_002131.3  
GGAGCACGCGGCGGCGGCGGTCTCTGAGCGCCTCTGCTCTCTCTCCCGGTTTCAGATCCG
HKR276634 ARiS191J18 pGCAP10 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR320853 RBb02C05 pKA1U5 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGCA
HKR323259 RBb08C11 pKA1U5 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR327754 RBb19G10 pKA1U5 NM_002131.3  
GGAGTTGTGCACCCGGCGGAGCCCGGAGGAGCCCGTTTNCACCTCGCGCGGCGGCCGCTC
HKR328526 RBb21F06 pKA1U5 NM_002131.3  
GTCCTCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGA
HKR329379 RBb23H11 pGCAP1 NM_002131.3  
TCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR330949 RBb27G05 pGCAP1 NM_002131.3  
TGCTCCTCTAATTGGGACTCCGTAGCCGGGGCTATTTCTGGCGNTGGNGCGGCTCCAAGA
HKR344078 RBb60D06 pGCAP1 NM_002131.3  
GCTCTCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGA
HKR346029 RBb65B05 pGCAP1 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR346859 RBb67C11 pGCAP1 NM_002131.3  
TTGCCTCTCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCA
HKR363308 RBd08E12 pGCAP10 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR374429 RBd36B05 pGCAP10 NM_002131.3  
GTCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGG
HKR374573 RBd36H05 pGCAP10 NM_002131.3  
GACGCGGCGGCGGCGGTCTCTGAGCGCCTCTGCTCTCTCTCCCGGTTTCAGATCCGCATT
HKR384926 RBd62F06 pGCAP10 NM_002131.3  
GATTCTGGCGCTGGCGCGGCTCCAAGAAGGCATCCGCATTTGCTACCAGCGGCGGCCGCG
HKR388036 RBd70B12 pGCAP10 NM_002131.3  
GAGAAGGCGTGAGTTCGCGGCCGCTCCGGTGGCTTCTTTTTTTTATATCTATAATTTAAT
HKR395699 RBd89E03 pGCAP10 NM_002131.3  
GCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGCA
HKR398554 RBd96G10 pGCAP10 NM_002131.3  
GGGACGGAAGCCGACCGGGGCGTGCGGAGGGATGTGGCCCGGAATATTGGTAGGGGGGGC
HKR399775 RBd99H07 pGCAP10 NM_002131.3  
TGCCTCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGA
HKR405301 RBdS013E05 pGCAP10 NM_002131.3  
GGCGGGCGGGCCCGTCCCCCCTGCCCCTGGGTCGCTCTTTTTAAGCTCCCCTGAGCCGGT
HKR405526 RBdS013N14 pGCAP10 NM_002131.3  
GGGGGGCCTGGGCGGCNAGCACGCGGCGGCGGCGGTCTCTGAGCGCCTCTGCTCTCTCTC
HKR405694 RBdS014D22 pGCAP10 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR416260 RBdS040K20 pGCAP10 NM_002131.3  
GATTTTCTGGCGCTGGCGCGGCTCCAAGAAGGCATCCGCATTTGCTACCAGCGGCGGCCG
HKR420579 RBdS051H11 pGCAP10 NM_002131.3  
GCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAAGGC
HKR442224 RBdS105J08 pGCAP10 NM_002131.3  
GGCTCCTCTAATTGGGACTCCGAGCCGGGGCTATTTCTGGCGCTGGCGCGGCTCCAAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl