Prev. |  KEGG KO K01641 > 

RIKEN DNA Bank Human Resource - HMGCS1

Gene ID NCBI Gene 3157 |  KEGG hsa:3157
Gene Symbol HMGCS1
Protein Name 3-hydroxy-3-methylglutaryl-CoA synthase 1
Synonyms HMGCS
Ortholog resource in our bank

  HMGCS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066482 IRAK166D10 pCMV-SPORT6 BC083514 NM_002130 Full
HGY080423 IRAL001A23 pOTB7 BC000297 NM_002130 Full/var
HGY103643 IRAL059B19 pOTB7 BC082234 NM_002130 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208363 ARiS020P03 pGCAP10 NM_002130.6  
GGACTGTCCTTTCGTGGCTCACTCCCTTTCCTCTGCTGCCGCTCGGTCACGCTTGCTCTT
HKR260255 ARiS150K15 pGCAP10 NM_002130.6  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl