Prev. |  KEGG KO K11300 > 

RIKEN DNA Bank Human Resource - HMGN2

Gene ID NCBI Gene 3151 |  KEGG hsa:3151
Gene Symbol HMGN2
Protein Name high mobility group nucleosomal binding domain 2
Synonyms HMG17
Ortholog resources KEGG ortholog (KEGG orthology K11300) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX053608 IRAK134A08 pCMV-SPORT6 BC061898 NM_005517 Partial
HGX053842 IRAK134K02 pCMV-SPORT6 BC064347 NM_005517 Partial
HGX066415 IRAK166A15 pCMV-SPORT6 BC071707 NM_005517 Full
HGY080462 IRAL001C14 pOTB7 BC000378 NM_005517 Full
HGY083316 IRAL008E20 pOTB7 BC003050 NM_005517 Full
HGY089169 IRAL022P09 pOTB7 BC014644 NM_005517 Full
HGY095919 IRAL039N07 pOTB7 BC032140 NM_005517 Full
HGY102851 IRAL057C03 pDNR-LIB BC070297 NM_005517 Full
HGY103236 IRAL058B12 pOTB7 BC081567 NM_005517 Full
HGY103417 IRAL058J01 pOTB7 BC072010 NM_005517 Full
HGY103418 IRAL058J02 pOTB7 BC075837 NM_005517
HGY103584 IRAL058P24 pOTB7 BC072011 NM_005517 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE020913 W01A052E17 pENTR-TOPO IRAL058J02 BC075837 NM_005517  
HGE020917 W01A052E21 pENTR-TOPO IRAL058J02 BC075837 NM_005517  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173273 ARi33D01 pGCAP10 NM_005517.3  
GCTAACCGGTCCGGGGCTCCCAGCGCTATAAAAACTTTATAAACCCCCCGGAGCCCGAGC
HKR177655 ARi44C07 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR180525 ARi51F05 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR234268 ARiS085L04 pGCAP10 NM_005517.3  
AAAAAAAACTTTATAAACCCCCCGGAGCCCGAGCAGTGTGAAGAAGAGGCGAGAACGACC
HKR247482 ARiS118L18 pGCAP10 NM_005517.3  
GGAGCNNTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR332058 RBb30C10 pGCAP1 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR340574 RBb51H06 pGCAP1 NM_005517.3  
GAGTGTGAAGAAGAGGCGAGAACGACCCCCGGAACCGACCAAAGCCCGCGCGCCGCTGCA
HKR361628 RBd04B04 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR364974 RBd12H06 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR365372 RBd13H04 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR366878 RBd17D06 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR369258 RBd23C10 pGCAP10 NM_005517.3  
GAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCTG
HKR380500 RBd51E04 pGCAP10 NM_005517.3  
GCGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGC
HKR381260 RBd53C12 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAANGCCCGCGCGCCGCT
HKR382498 RBd56E02 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAANCCCGCGCGCCGCT
HKR382553 RBd56G09 pGCAP10 NM_005517.3  
AAGGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCG
HKR382953 RBd57G09 pGCAP10 NM_005517.3  
GGCCTGTCGCGGTGGTGCGGGCTCCGCTGCCCTCCCCGGCTGCNCTCCGGTCCAGCCCTC
HKR384500 RBd61E04 pGCAP10 NM_005517.3  
TGGGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCG
HKR385330 RBd63F10 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR386130 RBd65F10 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR386427 RBd66B03 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR392121 RBd80F01 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR392551 RBd81G07 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR392807 RBd82A07 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR394547 RBd86G03 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR395705 RBd89E09 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR396954 RBd92G10 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR396980 RBd92H12 pGCAP10 NM_005517.3  
GAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCTG
HKR399601 RBd99A01 pGCAP10 NM_005517.3  
GGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCTGCATCCCGC
HKR399678 RBd99D06 pGCAP10 NM_005517.3  
GNANANAGCGAGANGACCCCGGACGACCAAAGCCGCGCGCGCTGCATCCCGCGTCCAGCA
HKR405322 RBdS013F02 pGCAP10 NM_005517.3  
GGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCTGCATCCCGC
HKR405417 RBdS013J01 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR405455 RBdS013K15 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAANANGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR405638 RBdS014B14 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR405691 RBdS014D19 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR406214 RBdS015I22 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR406271 RBdS015L07 pGCAP10 NM_005517.3  
GGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCTGCATCCCGC
HKR408829 RBdS022B05 pGCAP10 NM_005517.3  
GGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCTGCATCCCGC
HKR428335 RBdS070N23 pGCAP10 NM_005517.3  
GGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCTGCATCCCGC
HKR430020 RBdS075A20 pGCAP10 NM_005517.3  
TGGGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCTGCATCCC
HKR432402 RBdS081A02 pGCAP10 NM_005517.3  
CGGCCGGCCGATGCTAACCGGTCCGGGGCTCCCAGCGCTATAAAAACTTTATAAACCCCC
HKR432545 RBdS081G01 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAANANGCGANAACGACCCCCGGACCGACCNAAGCCCGCGCGCCGTT
HKR433458 RBdS083K18 pGCAP10 NM_005517.3  
GGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCTGCATCCCGC
HKR433461 RBdS083K21 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR433518 RBdS083N06 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR442294 RBdS105M06 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR442346 RBdS105O10 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR444121 RBdS110F01 pGCAP10 NM_005517.3  
GGAGCANTGTGAAGAANAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR470871 RBdS177C23 pGCAP10 NM_005517.3  
GGAGCAGTGTGAAGAAGAGGCGAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGCT
HKR471128 RBdS177N16 pGCAP10 NM_005517.3  
TGGANCAGTGTGAANANGAGGCNAGAACGACCCCCGGACCGACCAAAGCCCGCGCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl