Prev. |  KEGG KO K11299 > 

RIKEN DNA Bank Human Resource - HMGN1

Gene ID NCBI Gene 3150 |  KEGG hsa:3150
Gene Symbol HMGN1
Protein Name high mobility group nucleosome binding domain 1
Synonyms HMG14
Ortholog resources KEGG ortholog (KEGG orthology K11299) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX066783 IRAK166P23 pCMV-SPORT6 BC071643 NM_004965 Full/var
HGX069853 IRAK174K13 pCMV-SPORT6 BC072672 NM_004965 Full/var
HGY083132 IRAL007N20 pOTB7 BC000075 NM_004965 Full
HGY092919 IRAL032E23 pDNR-LIB BC023984 NM_004965 Full
HGY103000 IRAL057I08 pDNR-LIB BC070153 NM_004965 Full
HGY103031 IRAL057J15 pDNR-LIB BC070154 NM_004965 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050434 ARe26B10 pKA1U5 NM_004965.6  
GAGCAGCTCGGGCGGCGGGAGGAGTGGCAGCGGCAAGGCAGCCCAGTTTCGCGAAGGCTG
HKR058956 ARe47G12 pKA1U5 NM_004965.6  
GAGGAGTGGCAGCGGCAAGGCAGCCCAGTTTCGCGNTNNGCTGTCGGCGCGCCGCGGCCC
HKR161678 ARi04D06 pGCAP10 NM_004965.6  
GGGGACTGCGGCCCGCCTCTATTCGTGCGTCTCCGTCTCCGCAGGTCAGCTCCGCCGAAN
HKR175255 ARi38C07 pGCAP10 NM_004965.6  
GGTCTCAGCAGCTCGGGCGGCGGGAGGAGTGGCAGCGGCAAGGCAGCCCAGTTTCGCGAA
HKR181380 ARi53H12 pGCAP10 NM_004965.6  
AGAATCCGGTTCCATCCGGTTCTCCCACCGCCCCCGCTGTGGGTCTCAGCAGCTCGGGCG
HKR182049 ARi55C01 pGCAP10 NM_004965.6  
GGGTTCTCCCACCGCCCCCGCTGTGGGTCTCAGCAGCTCGGGCGGCGGGAGGAGTGGCAG
HKR323698 RBb09E02 pKA1U5 NM_004965.6  
GGTGGGTCTCAGCAGCTCGGGCGGCGGGAGGAGTGNCAGCGGCAAGGCAGCCCAGTTTCG
HKR330971 RBb27H03 pGCAP1 NM_004965.6  
GGCAGCGGCAAGGCAGCCCAGTTTCGCGAAGGCTGTCGGCGCGCCGCGGCCCGCAGGCAC
HKR336803 RBb42A03 pGCAP1 NM_004965.6  
GAGCGGCAAGGCAGCCCAGTTTCGCGAAGGCTGTCGGCGCGCCGCGGCCCGCAGGCACCC
HKR346831 RBb67B07 pGCAP1 NM_004965.6  
GGCAGGTCAGCTCCGCCGAAGGCGCCGCCAAGGAAGAGCCCAAGAGGAGATCGGCGCGGT
HKR363205 RBd08A05 pGCAP10 NM_004965.6  
GGGGAGGAGTGGCAGCGGCAAGGCAGCCCAGTTTCGCGAAGGCTGTCGGCGCGCCGCGGC
HKR364154 RBd10G10 pGCAP10 NM_004965.6  
GCTCAGCAGCTCGGGCGGCGGGAGGAGTGGCAGCGGCAAGGCAGCCCAGTTTCGCGAAGG
HKR365324 RBd13F04 pGCAP10 NM_004965.6  
GAGCAGCGGCAAGGCAGCCCAGTTTCGCGAAGGCTGTCGGCGCGCCGCGGCCCGCAGGCA
HKR368003 RBd20A03 pGCAP10 NM_004965.6  
GGTGGGTCTCAGCAGCTCGGGCGGCGGGAGGAGTGGCAGCGGCAAGGCAGCCCAGTTTCG
HKR389610 RBd74A10 pGCAP10 NM_004965.6  
GGTGGGTCTCAGCAGCTCGGGCGGCGGGAGGAGTGGCAGCGGCAAGGCAGCCCAGTTTCG
HKR395607 RBd89A07 pGCAP10 NM_004965.6  
GGTGGCAGCGCCCAGGCAGCCCTGTTTCGCGAAGGCTGTCGGCGCGCCGCGGCCCGCAGG
HKR398077 RBd95D05 pGCAP10 NM_004965.6  
GTGGGTCTCAGCAGCTCGGGCGGCGGGAGGAGTGGCAGCGGCAAGGCAGCCCAGTTTCGC
HKR405535 RBdS013N23 pGCAP10 NM_004965.6  
GACCGCCCCCGCTGTGGGTCTCAGCAGCTCGGGCGGCGGGAGGAGTGGCAGCGGCAAGGC
HKR406058 RBdS015C10 pGCAP10 NM_004965.6  
TGGGTTCCATCCGGTTCTCCCACCGCCCCCGCTGTGGGTCTCAGCAGCTCGGGCGGCGGG
HKR416112 RBdS040E16 pGCAP10 NM_004965.6  
GGGCNGCGGGTNNGCCGCCCNGTTNCNNGAANGNTGTNNGNNCNCCNNNNCCCNNNNGCN
HKR420495 RBdS051D23 pGCAP10 NM_004965.6  
GAGCCCAGTTTCGCGAAGGCTGTCGGCGCGCCGCGGCCCGCAGGCACCCGGCACGCGCCT
HKR420546 RBdS051G02 pGCAP10 NM_004965.6  
GATCCGGTTCTCCCACCGCCCCCGCTGTGGGTCTCAGCAGCTCGGGCGGCGGGAGGAGTG
HKR420672 RBdS051L08 pGCAP10 NM_004965.6  
GGCCCCCGCTGTGGGTCTCAGCAGCTCGGGCGGCGGGAGGAGTGGCAGCGGCAAGGCAGC
HKR428120 RBdS070E24 pGCAP10 NM_004965.6  
GAGCGGCAAGGCAGCCCAGTTTCGCGAAGGCTGTCGGCGCGCCGCGGCCCGCAGGCACCC
HKR428370 RBdS070P10 pGCAP10 NM_004965.6  
GAGTTTCGCGAAGGCTGTCGGCGCGCCGCGGCCCGCAGGCACCCGGCACGCGCCTTCCCC
HKR430138 RBdS075F18 pGCAP10 NM_004965.6  
GAGCANNNNGGGCGGCGGGAGGAGTGGCAGCGGCAAGGCAGCCCAGTTTCGCGAAGGCTG
HKR432456 RBdS081C08 pGCAP10 NM_004965.6  
GAGCGGCAAGGCAGCCCAGTTTCGCGAAGGCTGTCGGCGCGCCGCGGCCCGCAGGCACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl