Prev. |  KEGG KO K11296 > 

RIKEN DNA Bank Human Resource - HMGB3

Gene ID NCBI Gene 3149 |  KEGG hsa:3149
Gene Symbol HMGB3
Protein Name high mobility group box 3
Synonyms HMG-2a|HMG-4|HMG2A|HMG4
Ortholog resources KEGG ortholog (KEGG orthology K11296) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX017028 IRAK042J12 pCMV-SPORT6 BC037210 NM_005342 Full
HGX069808 IRAK174I16 pCMV-SPORT6 BC070482 NM_005342 Full
HGY089119 IRAL022N07 pOTB7 BC007608

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR332004 RBb30A04 pGCAP1 NM_005342.2  
TGAGACTAGCGAACAATACAGTCAGGATGGCTAAAGGTGACCCCAAGAAACCAAAGGGCA
HKR339332 RBb48F12 pGCAP1 NM_005342.2  
GGCGGCTCTCGCTGGAGGCAGCTAGCGCGAGGCTTGGGGAGCGCTGAGCCGCGCGNTCGT
HKR347704 RBb69E08 pGCAP1 NM_005342.2  
AGACTAGCGAACAATACAGTCAGGATGGCTAAAGGTGACCCCAAGAAACCAAAGGGCAAG
HKR367227 RBd18B03 pGCAP10 NM_005342.2  
GAGACTAGCGAACAATACAGTCAGGATGGCTAAAGGTGACCCCAAGAAACCAAAGGGCAA
HKR391660 RBd79C12 pGCAP10 NM_005342.2  
GGCGCGTCGTGCCCTGCGCTGCCCAGACTAGCGAACAATACAGTCAGGATGGCTAAAGGT
HKR402868 RBdS007C20 pGCAP10 NM_005342.2  
GAGGCGGCTCTCGTGGAGGCAGCTAGCGCGAGGCTGGGGAGCGCTGAGCCGCGCGTCGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl