Prev. |  KEGG KO K11295 > 

RIKEN DNA Bank Human Resource - HMGB2

Gene ID NCBI Gene 3148 |  KEGG hsa:3148
Gene Symbol HMGB2
Protein Name high mobility group box 2
Synonyms HMG2
Ortholog resources KEGG ortholog (KEGG orthology K11295) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001553 IRAK003O17 pCMV-SPORT6 BC000903 NM_002129 Full/var
HGY081080 IRAL002L16 pOTB7 BC001063 NM_002129 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000779 W01A001P19 pENTR-TOPO IRAL002L16 BC001063 NM_002129  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050931 ARe27F11 pKA1U5 NM_002129.3  
GAGCGCCCGCCCTGGCAGCTGCGGGCTCCGCGCCGACCCTCCGGCTTCCCCTCTCCCCCC
HKR163306 ARi08E10 pGCAP10 NM_002129.3  
GAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCCGCTCTGCGGGA
HKR188002 ARi70A02 pGCAP10 NM_002129.3  
GGTTAATGGGAGATTCAAGGCCAAGAGGATGGAAGGCATTTTTTCTTTTCTTCTGGCTCC
HKR205264 ARiS013C16 pGCAP10 NM_002129.3  
GAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCCGCTCTGCGGGACTCTGAGGAAAA
HKR238709 ARiS096M21 pGCAP10 NM_002129.3  
GAGTTCACGCCGGANCCCCGTGAGGGAANCGTCTCCGTTGGGTCCGGCCGCTCTGCGGGA
HKR277950 ARiS194O14 pGCAP10 NM_002129.3  
GAGTTCCNNNCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCCGCTCTGCGGGA
HKR338521 RBb46F01 pGCAP1 NM_002129.3  
AAATGTCTTGGATTTTTCCTTCAGTTTATTAAACTCTGTTGCTTCCTTTCAGATCTGCCT
HKR338908 RBb47E12 pGCAP1 NM_002129.3  
AGTTCACGCCGGTAGCCCCGTTGTAGGGAAGCGTCTCCGTTGGGTCCGGCCGCTCTGCGG
HKR360547 RBd01G03 pGCAP10 NM_002129.3  
GAGAGATAAACCAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCC
HKR362010 RBd05A10 pGCAP10 NM_002129.3  
TGAAACCAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCCGCTCT
HKR370005 RBd25A05 pGCAP10 NM_002129.3  
GGTCTGGCTCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGG
HKR370433 RBd26B09 pGCAP10 NM_002129.3  
GAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCACTGGG
HKR370873 RBd27D01 pGCAP10 NM_002129.3  
GGCGTCTGGCTCCCGCTCTCACAGCCATTGCTGTACATTGAGCTCCATAGAGACAGCGCC
HKR371659 RBd29C11 pGCAP10 NM_002129.3  
GAGATAAACCAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCCGC
HKR392826 RBd82B02 pGCAP10 NM_002129.3  
GAGAGATAAACCAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCC
HKR397353 RBd93G09 pGCAP10 NM_002129.3  
GAAAAACCAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCCGCTC
HKR399659 RBd99C11 pGCAP10 NM_002129.3  
GAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCCGCTCTGCGGGA
HKR428061 RBdS070C13 pGCAP10 NM_002129.3  
GAGAGATAAACCAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCC
HKR428140 RBdS070F20 pGCAP10 NM_002129.3  
GAAAAACCAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCCGCTC
HKR430377 RBdS075P17 pGCAP10 NM_002129.3  
GCTAGCTCGTCAAGTTGCCGTGGCGCGGAGAACTCTGCAAAACAAGAGGCTGAGGATTGC
HKR444339 RBdS110O03 pGCAP10 NM_002129.3  
GAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCCGCTCTGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl