Prev. |  KEGG KO K01749 > 

RIKEN DNA Bank Human Resource - HMBS

Gene ID NCBI Gene 3145 |  KEGG hsa:3145
Gene Symbol HMBS
Protein Name hydroxymethylbilane synthase
Synonyms PBG-D|PBGD|PORC|UPS
Ortholog resource in our bank

  HMBS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005003 IRAK012I11 pCMV-SPORT6 BC008149 NM_001024382 Full
HGY080640 IRAL001J24 pOTB7 BC000520 NM_001024382 Full
HGY083748 IRAL009G04 pOTB7 BC019323 NM_001024382 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR334145 RBb35G01 pGCAP1 NM_000190.3  
GGGAGTGACGCGAGGCTCTGCGGAGACCAGGAGTCAGACTGTAGGACGACCTCGGGTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl