Prev. |  KEGG KO K06752 > 

RIKEN DNA Bank Human Resource - HLA-DRA

Gene ID NCBI Gene 3122 |  KEGG hsa:3122
Gene Symbol HLA-DRA
Protein Name major histocompatibility complex, class II, DR alpha
Synonyms HLA-DRA1
Featured content HLA - human
Featured content Intestinal immune network for IgA production - human
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  HLA-DRA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01232 DRA2EH Human HLA-DRA cDNA
RDB07389 pGL4-phHLA-DRA Promoter collection, Human HLA-DRA promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025864 IRAK064K24 pCMV-SPORT6 BC032350 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048551 ARe21G07 pKA1U5 NM_019111.3  
GAGTGTAGCCTCCGCCTCCCGATTGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGC
HKR053234 ARe33B10 pKA1U5 NM_019111.3  
GACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTGCCTGACCACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl