Prev. | Human A to Z list > H > 

RIKEN DNA Bank Human Resource - HLA-C

Gene ID (NCBI) 3107
Gene Symbol HLA-C
Protein Name major histocompatibility complex, class I, C
Synonyms D6S204|HLA-JY3|HLAC|HLC-C|MHC|PSORS1
Databases KEGG hsa:3107 |  NCBI Gene 3107
Featured content Endocytosis (human)
Featured content HLA - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06751)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01177 pAC201 Human HLA - Cx52 (Cw12) genomic, p201-31
RDB01179 pC68 Human HLA - Cx52 (Cw12) cDNA
RDB02883 Human HLA-C*01:02 cDNA Human HLA-C*01:02 cDNA from human EBV-transformed B cell line cDNA
RDB02884 Human HLA-C*03:03:01 cDNA Human HLA-C*03:03:01 cDNA from human EBV-transformed B cell line cDNA
RDB02885 Human HLA-C*03:04:01 cDNA Human HLA-C*03:04:01 cDNA from human EBV-transformed B cell line cDNA
RDB02886 Human HLA-C*04:01:01 cDNA Human HLA-C*04:01:01 cDNA from human EBV-transformed B cell line cDNA
RDB02887 Human HLA-C*07:02 cDNA Human HLA-C*07:02 cDNA from human EBV-transformed B cell line cDNA
RDB02888 Human HLA-C*08:01 cDNA Human HLA-C*08:01 cDNA from human EBV-transformed B cell line cDNA
RDB02889 Human HLA-C*12:02:02 cDNA Human HLA-C*12:02:02 cDNA from human EBV-transformed B cell line cDNA
RDB02890 Human HLA-C*14:03 cDNA Human HLA-C*14:03 cDNA from human EBV-transformed B cell line cDNA
RDB03376 Human HLA-C*01:03 cDNA Human HLA-C*01:03 cDNA from human EBV-transformed B cell line cDNA
RDB03377 Human HLA-C*06:02 cDNA Human HLA-C*06:02 cDNA from human EBV-transformed B cell line cDNA
RDB03378 Human HLA-C*14:02:01 cDNA Human HLA-C*14:02:01 cDNA from human EBV-transformed B cell line cDNA
RDB03379 Human HLA-C*15:02:01 cDNA Human HLA-C*15:02:01 cDNA from human EBV-transformed B cell line cDNA
RDB04478 SEREX clone BRC-Co-16 #1 SEREX clone BRC-Co-16 #1

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX007733 IRAK019F13 pCMV-SPORT6 BC010542 -
HGX011896 IRAK029M08 pCMV-SPORT6 BC033293 -
HGY082329 IRAL005N17 pOTB7 BC002463 -
HGY085701 IRAL014E05 pOTB7 BC004489 -
HGY088291 IRAL020M03 pOTB7 BC007814 -
HGY088506 IRAL021E10 pDNR-LIB BC008457 -

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071704 ARe79E08 pKA1U5 NM_002117.4  
GATTCTCCCCAGAGGCCGAGATGCGGGTCATGGCGCCCCGAGCCCTCCTCCTGCTGCTCT
HKR079772 ARe99H04 pKA1U5 NM_002117.4  
ACATTCTCCCCAGAGGCCGAGATGCGGGTCATGGCGCCCCGAGCCCTCCTCCTGCTGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.31

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl