DNA Bank Top |  KEGG KO K06751 > 

RIKEN DNA Bank Human Resource - HLA-C

Gene ID NCBI Gene 3107 |  KEGG hsa:3107
Gene Symbol HLA-C
Protein Name major histocompatibility complex, class I, C
Synonyms D6S204|HLA-JY3|HLAC|HLC-C|MHC|PSORS1
Featured content Endocytosis (human)
Featured content HLA - human

Link

Ortholog resource in our bank

  HLA-C

External database

human HLA-C

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04478 SEREX clone BRC-Co-16 #1 SEREX clone BRC-Co-16 #1    
RDB03379 Human HLA-C*15:02:01 cDNA Human HLA-C*15:02:01 cDNA from human EBV-transformed B cell line cDNA    
RDB03378 Human HLA-C*14:02:01 cDNA Human HLA-C*14:02:01 cDNA from human EBV-transformed B cell line cDNA    
RDB03377 Human HLA-C*06:02 cDNA Human HLA-C*06:02 cDNA from human EBV-transformed B cell line cDNA    
RDB03376 Human HLA-C*01:03 cDNA Human HLA-C*01:03 cDNA from human EBV-transformed B cell line cDNA    
RDB02890 Human HLA-C*14:03 cDNA Human HLA-C*14:03 cDNA from human EBV-transformed B cell line cDNA    
RDB02889 Human HLA-C*12:02:02 cDNA Human HLA-C*12:02:02 cDNA from human EBV-transformed B cell line cDNA    
RDB02888 Human HLA-C*08:01 cDNA Human HLA-C*08:01 cDNA from human EBV-transformed B cell line cDNA    
RDB02887 Human HLA-C*07:02 cDNA Human HLA-C*07:02 cDNA from human EBV-transformed B cell line cDNA    
RDB02886 Human HLA-C*04:01:01 cDNA Human HLA-C*04:01:01 cDNA from human EBV-transformed B cell line cDNA    
RDB02885 Human HLA-C*03:04:01 cDNA Human HLA-C*03:04:01 cDNA from human EBV-transformed B cell line cDNA    
RDB02884 Human HLA-C*03:03:01 cDNA Human HLA-C*03:03:01 cDNA from human EBV-transformed B cell line cDNA    
RDB02883 Human HLA-C*01:02 cDNA Human HLA-C*01:02 cDNA from human EBV-transformed B cell line cDNA    
RDB01179 pC68 Human HLA - Cx52 (Cw12) cDNA    
RDB01177 pAC201 Human HLA - Cx52 (Cw12) genomic, p201-31    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011896 IRAK029M08 pCMV-SPORT6 BC033293 - Full
HGX007733 IRAK019F13 pCMV-SPORT6 BC010542 - Partial
HGY082329 IRAL005N17 pOTB7 BC002463 - Full
HGY085701 IRAL014E05 pOTB7 BC004489 - Full
HGY088291 IRAL020M03 pOTB7 BC007814 - Partial
HGY088506 IRAL021E10 pDNR-LIB BC008457 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071704 ARe79E08 pKA1U5 NM_002117.4  
GATTCTCCCCAGAGGCCGAGATGCGGGTCATGGCGCCCCGAGCCCTCCTCCTGCTGCTCT
HKR079772 ARe99H04 pKA1U5 NM_002117.4  
ACATTCTCCCCAGAGGCCGAGATGCGGGTCATGGCGCCCCGAGCCCTCCTCCTGCTGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2025.04.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl