Prev. | Human A to Z list > H > 

RIKEN DNA Bank Human Resource - HLA-B

Gene ID (NCBI) 3106
Gene Symbol HLA-B
Protein Name major histocompatibility complex, class I, B
Synonyms AS|B-4901|HLAB
Databases KEGG hsa:3106 |  NCBI Gene 3106
Featured content Endocytosis (human)
Featured content HLA - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06751)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01176 pA01 Human HLA-A24 cDNA
RDB01178 AM2.60 Human HLA - B44 genomic DNA
RDB01180 pB55 Human HLA - B52 cDNA
RDB01686 pCDM-65B2C5/32 Human MHC class IB cDNA, retrovirus vector
RDB02874 Human HLA-B*07:02:01 cDNA Human HLA-B*07:02:01 cDNA from human EBV-transformed B cell line cDNA
RDB02875 Human HLA-B*15:01:01 cDNA Human HLA-B*15:01:01 cDNA from human EBV-transformed B cell line cDNA
RDB02876 Human HLA-B*35:01:01 cDNA Human HLA-B*35:01:01 cDNA from human EBV-transformed B cell line cDNA
RDB02877 Human HLA-B*40:01:02 cDNA Human HLA-B*40:01:02 cDNA from human EBV-transformed B cell line cDNA
RDB02878 Human HLA-B*40:02 cDNA Human HLA-B*40:02 cDNA from human EBV-transformed B cell line cDNA
RDB02879 Human HLA-B*44:03:01 cDNA Human HLA-B*44:03:01 cDNA from human EBV-transformed B cell line cDNA
RDB02880 Human HLA-B*46:01 cDNA Human HLA-B*46:01 cDNA from human EBV-transformed B cell line cDNA
RDB02881 Human HLA-B*51:01:01 cDNA Human HLA-B*51:01:01 cDNA from human EBV-transformed B cell line cDNA
RDB02882 Human HLA-B*52:01:01 cDNA Human HLA-B*52:01:01 cDNA from human EBV-transformed B cell line cDNA
RDB03369 Human HLA-B*08:01 cDNA Human HLA-B*08:01 cDNA from human EBV-transformed B cell line cDNA
RDB03370 Human HLA-B*38:01 cDNA Human HLA-B*38:01 cDNA from human EBV-transformed B cell line cDNA
RDB03371 Human HLA-B*39:01:01 cDNA Human HLA-B*39:01:01 cDNA from human EBV-transformed B cell line cDNA
RDB03372 Human HLA-B*48:01 cDNA Human HLA-B*48:01 cDNA from human EBV-transformed B cell line cDNA
RDB03373 Human HLA-B*54:01 cDNA Human HLA-B*54:01 cDNA from human EBV-transformed B cell line cDNA
RDB03374 Human HLA-B*55:02 cDNA Human HLA-B*55:02 cDNA from human EBV-transformed B cell line cDNA
RDB03375 Human HLA-B*59:01 cDNA Human HLA-B*59:01 cDNA from human EBV-transformed B cell line cDNA
RDB03441 phHLA-B*15011_i_EGFP Expression vector of human HLA-B*15011

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010665 IRAK026L01 pCMV-SPORT6 BC013187 -
HGY088861 IRAL022C13 pOTB7 BC007243 -

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043676 ARe09D04 pKA1U5 NM_005514.6  
GAGAGTCTCCTCAGACGCCGAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGCT
HKR068151 ARe70G07 pKA1U5 NM_005514.6  
GCCCAGAGGCCGAGATGCGGGTCATGGCGCCCCGAGNCCTCCTCCTGCTGCTCTCGGGAG
HKR072432 ARe81B08 pKA1U5 NM_005514.6  
GAGAGTCTCCTCAGACGCCGAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGCT
HKR072500 ARe81E04 pKA1U5 NM_005514.6  
GAGAGTCTCCTCAGACGCCAAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGCT
HKR073754 ARe84G10 pKA1U5 NM_005514.6  
GAGAGTCTCCTCAGACGCCGAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGCT
HKR160406 ARi01A06 pGCAP10 NM_005514.6  
GAGAGTCTCCTCTTACGCCAAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGCT
HKR171706 ARi29E10 pGCAP10 NM_005514.6  
GACTCACATTCTCCCCAGAGGCCGAGATGCGGGTCATGGCGCCCCGAGCCCTCCTCCTGC
HKR174428 ARi36B04 pGCAP10 NM_005514.6  
GAGAGTCTCCTCAGACGCCGAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGCT
HKR177348 ARi43G04 pGCAP10 NM_005514.6  
TTGAGAGTCTCCTCAGACGCCAAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTG
HKR188481 ARi71D09 pGCAP10 NM_005514.6  
GTCAGAGTCTCCTCAGACGCCGAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTG
HKR209263 ARiS023C15 pGCAP10 NM_005514.6  
GAGAGTCTCCTCAGACGCCGAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGCT
HKR222337 ARiS055O01 pGCAP10 NM_005514.6  
GAGACNCCNAGATGCGGGTCATGGCGCCCCGAACCCTCATCCTGCTGCTCTCGGGAGCCC
HKR234958 ARiS087G14 pGCAP10 NM_005514.6  
GAGAGTCTCCTCAGACGCCAAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGCT
HKR235554 ARiS088O18 pGCAP10 NM_005514.6  
GAGACGCCGAGATGCGGGTCATGGCGCCCCGAACCCTCATCCTGCTGCTCTCGGGAGCCC
HKR243835 ARiS109J19 pGCAP10 NM_005514.6  
GAGAGTCTCCTCAGACGCCGAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGCT
HKR260376 ARiS150P16 pGCAP10 NM_005514.6  
TGGGATTCTCCCCAGACGCCGAGATGCGGGTCATGGCGCCCCGAACCCTCATCCTGCTGC
HKR276436 ARiS191B12 pGCAP10 NM_005514.6  
TGAGAGTCTCCTCAGACGCCAAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGC
HKR276534 ARiS191F14 pGCAP10 NM_005514.6  
TGAGAGTCTCCTCAGACGCCAAGATGCTGGTCATGGCGCCCCGAACCGTCCTCCTGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.31

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl