Prev. | Human A to Z list > H > 

RIKEN DNA Bank Human Resource - HLA-A

Gene ID (NCBI) 3105
Gene Symbol HLA-A
Protein Name major histocompatibility complex, class I, A
Synonyms HLAA
Databases KEGG hsa:3105 |  NCBI Gene 3105
Featured content Endocytosis (human)
Featured content HLA - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06751)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02866 Human HLA-A*02:01:01 cDNA Human HLA-A*02:01:01 cDNA from human EBV-transformed B cell line cDNA
RDB02867 Human HLA-A*02:06 cDNA Human HLA-A*02:06 cDNA from human EBV-transformed B cell line cDNA
RDB02868 Human HLA-A*02:07 cDNA Human HLA-A*02:07 cDNA from human EBV-transformed B cell line cDNA
RDB02869 Human HLA-A*11:01:01 cDNA Human HLA-A*11:01:01 cDNA from human EBV-transformed B cell line cDNA
RDB02870 Human HLA-A*26:01 cDNA Human HLA-A*26:01 cDNA from human EBV-transformed B cell line cDNA
RDB02871 Human HLA-A*24:02:01 cDNA Human HLA-A*24:02:01 cDNA from human EBV-transformed B cell line cDNA
RDB02872 Human HLA-A*31:01:02 cDNA Human HLA-A*31:01:02 cDNA from human EBV-transformed B cell line cDNA
RDB02873 Human HLA-A*33:03 cDNA Human HLA-A*33:03 cDNA from human EBV-transformed B cell line cDNA
RDB03365 Human HLA-A*24:20 cDNA Human HLA-A*24:20 cDNA from human EBV-transformed B cell line cDNA
RDB03366 Human HLA-A*26:03 cDNA Human HLA-A*26:03 cDNA from human EBV-transformed B cell line cDNA
RDB03367 Human HLA-A*03:01 cDNA Human HLA-A*03:01 cDNA from human EBV-transformed B cell line cDNA
RDB03368 Human HLA-A*01:01 cDNA Human HLA-A*01:01 cDNA from human EBV-transformed B cell line cDNA
RDB03440 phHLA-A*2601_i_EGFP Expression vector of human HLA-A*2601

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX004917 IRAK012E21 pCMV-SPORT6 BC008611 -
HGY080967 IRAL002G23 pOTB7 BC019236 -
HGY082896 IRAL007D24 pOTB7 BC003069 -

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045326 ARe13F06 pKA1U5 NM_002116.5  
ATCCTGAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCCTCGTCCT
HKR072532 ARe81F12 pKA1U5 NM_002116.5  
GAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTAC
HKR075651 ARe89C03 pKA1U5 NM_002116.5  
AGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCCTCGTCCTGCTACT
HKR081210 ARf03A10 pKA1U5 NM_002116.5  
TTAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCCTCGTCCTGCTA
HKR183724 ARi59F04 pGCAP10 NM_002116.5  
CGGCCGGCCGATGAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCC
HKR203236 ARiS008B12 pGCAP10 NM_002116.5  
GAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTAC
HKR260264 ARiS150K24 pGCAP10 NM_002116.5  
GAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTAC
HKR321731 RBb04F11 pKA1U5 NM_002116.5  
GAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGNGCCCCGAACCCTCGTCCTGCTAC
HKR366101 RBd15E05 pGCAP10 NM_002116.5  
CGGCCGGCCGATGAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.31

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl