Prev. |  KEGG KO K00844 > 

RIKEN DNA Bank Human Resource - HK1

Gene ID NCBI Gene 3098 |  KEGG hsa:3098
Gene Symbol HK1
Protein Name hexokinase 1
Synonyms HK|HK1-ta|HK1-tb|HK1-tc|HKD|HKI|HMSNR|HXK1|RP79|hexokinase
Ortholog resources KEGG ortholog (KEGG orthology K00844) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content HIF-1 signaling pathway - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082251 IRAL005K11 pOTB7 BC008730 NM_000188 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050927 ARe27F07 pKA1U5 NM_000188.2  
GAGGAGGAGCCGCCGAGCAGCCGCCGGAGGACCACGGCTCGCCAGGGCTGCGGAGGACCG
HKR203310 ARiS008E14 pGCAP10 NM_000188.2  
GGGAGGAGCCGCCGAGCAGCCGCCGGAGGACCACGGCTCGCCAGGGCTGCGGAGGACCGA
HKR320434 RBb01B10 pKA1U5 NM_000188.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl