RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - HK1

Gene ID	NCBI Gene 3098 \| KEGG hsa:3098
Gene Symbol	HK1
Protein Name	hexokinase 1
Synonyms	HK\|HK1-ta\|HK1-tb\|HK1-tc\|HKD\|HKI\|HMSNR\|HXK1\|NEDVIBA\|RP79\|hexokinase
Featured content	Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content	HIF-1 signaling pathway - human

Ortholog resource in our bank

  HK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY082251	IRAL005K11	pOTB7	BC008730	NM_000188	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR050927	ARe27F07	pKA1U5	NM_000188.2
HKR050927	GAGGAGGAGCCGCCGAGCAGCCGCCGGAGGACCACGGCTCGCCAGGGCTGCGGAGGACCG
HKR203310	ARiS008E14	pGCAP10	NM_000188.2
HKR203310	GGGAGGAGCCGCCGAGCAGCCGCCGGAGGACCACGGCTCGCCAGGGCTGCGGAGGACCGA
HKR320434	RBb01B10	pKA1U5	NM_000188.2
HKR320434

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl