Prev. |  KEGG KO K02503 > 

RIKEN DNA Bank Human Resource - HINT1

Gene ID NCBI Gene 3094 |  KEGG hsa:3094
Gene Symbol HINT1
Protein Name histidine triad nucleotide binding protein 1
Synonyms HINT|NMAN|PKCI-1|PRKCNH1
Ortholog resources KEGG ortholog (KEGG orthology K02503) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001940 IRAK004O04 pCMV-SPORT6 BC001287 NM_005340 Full
HGY088602 IRAL021I10 pDNR-LIB BC007090 NM_005340 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049612 ARe24A12 pKA1U5 NM_005340.5  
GCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGA
HKR057649 ARe44C01 pKA1U5 NM_005340.5  
GCCTCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAG
HKR069678 ARe74D06 pKA1U5 NM_005340.5  
GCTCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGA
HKR075372 ARe88H04 pKA1U5 NM_005340.5  
GGTGGGGCGCCAGAGCCGGGGCACCTGCGCAGGCTTGACTGCGCCCTCTCGCGCCGCACG
HKR078878 ARe97D06 pKA1U5 NM_005340.5  
GGCGCCGCACGCTCTGCGGGTTCCTCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCG
HKR161611 ARi04A11 pGCAP10 NM_005340.5  
GCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGAG
HKR165605 ARi14A05 pGCAP10 NM_005340.5  
GGCACGCTCTGCGGGTTCCTCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGA
HKR168878 ARi22D06 pGCAP10 NM_005340.5  
GCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGAGATTGCCA
HKR170579 ARi26H11 pGCAP10 NM_005340.5  
GCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATG
HKR182434 ARi56B10 pGCAP10 NM_005340.5  
GTGGGGGCGCCAGAGCCGGGGCACCTGCGCAGGCTTGGCTGCGCCCTCTCGCGCCGCACG
HKR183748 ARi59G04 pGCAP10 NM_005340.5  
GGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGAGATTGCCAA
HKR185203 ARi63A03 pGCAP10 NM_005340.5  
GGGGGCACCTGCGCAGGCTTGGCTGCGCCCTCTCGCGCCGCACGCTCTGCGGGTTCCTCC
HKR205292 ARiS013D20 pGCAP10 NM_005340.5  
GGGGGCACCTGCGCAGGCTTGGCTGCGCCCTCTCGCGCCGCACGCTCTGCGGGTTCCTCC
HKR209520 ARiS023N08 pGCAP10 NM_005340.5  
GCTCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGA
HKR235267 ARiS088C19 pGCAP10 NM_005340.5  
GTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGAGATTGCCAAGGCTC
HKR249059 ARiS122K19 pGCAP10 NM_005340.5  
GCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATG
HKR264481 ARiS161D09 pGCAP10 NM_005340.5  
GCTCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGA
HKR320505 RBb01E09 pKA1U5 NM_005340.5  
GCTCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGA
HKR323350 RBb08G06 pKA1U5 NM_005340.5  
HKR323601 RBb09A01 pKA1U5 NM_005340.5  
GATTAGGTGGGGCGCCAGAGCCGGGGCACCTGCGCAGGCTTGGCTGCGCCCTCTCGCGCC
HKR324151 RBb10G07 pKA1U5 NM_005340.5  
TGTGCGCCCTCTCGCGCCGCACGCTCTGCGGGTTCCTCCCTTCTTCCGAGCCTCTCCTCT
HKR331610 RBb29A10 pGCAP1 NM_005340.5  
GGCCCTCTCGCGCCGCACGCTCTGCGGGTTCCTCCCTTCTTCCGAGCCTCTCCTCTGGCC
HKR345636 RBb64B12 pGCAP1 NM_005340.5  
GCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGAGATTGCCAAGGCT
HKR346577 RBb66H09 pGCAP1 NM_005340.5  
GTGGGCGGGAGAGAGGCCGAGATGGCAGATGAGATTGCCAAGGCTCAGGTCGCTCGGCCT
HKR348175 RBb70H07 pGCAP1 NM_005340.5  
GGAGATGGCAGATGAGATTGCCAAGGCTCAGGTCGCTCGGCCTGGTGGCGACACGATCTT
HKR365658 RBd14C10 pGCAP10 NM_005340.5  
GGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGAGATTGCCAAGGCTCAGGTCGCTCGGC
HKR379212 RBd48A12 pGCAP10 NM_005340.5  
GGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGAGATTGCCAAGG
HKR385253 RBd63C05 pGCAP10 NM_005340.5  
GGCGCCGCACGCTCTGCGGGTTCCTCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCG
HKR388026 RBd70B02 pGCAP10 NM_005340.5  
GTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGAGATTGCCAAGGCTCAGGTCGC
HKR394054 RBd85C06 pGCAP10 NM_005340.5  
GGCAGGCTTGGCTGCGCCCTCTCGCGCCGCACGCTCTGCGGGTTCCTCCCTTCTTCCGAG
HKR394860 RBd87C12 pGCAP10 NM_005340.5  
GAGGCTTGGCTGCGCCCTCTCGCGCCGCACGCTCTGCGGGTTCCTCCCTTCTTCCGAGCC
HKR396035 RBd90B11 pGCAP10 NM_005340.5  
GCCCTTCTTCCGAGCCTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATG
HKR396036 RBd90B12 pGCAP10 NM_005340.5  
GCTCTTCTTCCTGCCCTCTCCTCTGGCCCCCCCGCGGGAGAGAGGCCGAAATGGCCTATG
HKR402977 RBdS007H09 pGCAP10 NM_005340.5  
GGCAGGCTTGGCTGCGCCCTCTCGCGCCGCACGCTCTGCGGGTTCCTCCCTTCTTCCGAG
HKR406177 RBdS015H09 pGCAP10 NM_005340.5  
GGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGAGATTGCCAAGGCTCAGGTCGCT
HKR441725 RBdS104F05 pGCAP10 NM_005340.5  
GGCCCTCTCGCGCCGCACGCTCTGCGGGTTCCTCCCTTCTTCCGAGCCTCTCCTCTGGCC
HKR452896 RBdS132D24 pGCAP10 NM_005340.5  
GTCTCCTCTGGCCGCCGCGCGGGAGAGAGGCCGAGATGGCAGATGAGATTGCCAAGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl