Prev. |  KEGG KO K08024 > 

RIKEN DNA Bank Human Resource - HHEX

Gene ID NCBI Gene 3087 |  KEGG hsa:3087
Gene Symbol HHEX
Protein Name hematopoietically expressed homeobox
Synonyms HEX|HMPH|HOX11L-PEN|PRH|PRHX
Ortholog resources KEGG ortholog (KEGG orthology K08024) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044329 IRAK110N17 pCMV-SPORT6 BC050638 NM_002729 Full
HGY092741 IRAL031O05 pDNR-LIB BC015110 NM_002729 Full
HGY092726 IRAL031N14 pDNR-LIB BC014336 NM_002729 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000937 W01A002F17 pENTR-TOPO IRAL031O05 BC015110 NM_002729  
HGE000939 W01A002F19 pENTR-TOPO IRAL031O05 BC015110 NM_002729  
HGE000943 W01A002F23 pENTR-TOPO IRAL031O05 BC015110 NM_002729  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR395250 RBd88C02 pGCAP10 NM_002729.4  
GGCGAGGGGCCGGAGCGCGGCGGAGCCATGCAGTACCCGCACCCCGGGCCGGCGGCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl