Prev. |  KEGG KO K12373 > 

RIKEN DNA Bank Human Resource - HEXB

Gene ID NCBI Gene 3074 |  KEGG hsa:3074
Gene Symbol HEXB
Protein Name hexosaminidase subunit beta
Synonyms ENC-1AS|HEL-248|HEL-S-111
Featured content Lysosome (human)
Ortholog resource in our bank

  HEXB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081311 IRAL003E15 pOTB7 BC017378 NM_000521 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE085224 M01C013A24 pDONR221 FLJ04-B12 AK130375 ENST00000380533  
HGE085272 M01C013C24 pDONR221 FLJ04-B12 AK130375 ENST00000380533  
HGE085320 M01C013E24 pDONR221 FLJ04-B12 AK130375 ENST00000380533  
HGE085368 M01C013G24 pDONR221 FLJ04-B12 AK130375 ENST00000380533  
HGE085416 M01C013I24 pDONR221 FLJ04-B12 AK130375 ENST00000380533  
HGE085464 M01C013K24 pDONR221 FLJ04-B12 AK130375 ENST00000380533  
HGE085512 M01C013M24 pDONR221 FLJ04-B12 AK130375 ENST00000380533  
HGE085560 M01C013O24 pDONR221 FLJ04-B12 AK130375 ENST00000380533  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067708 ARe69E12 pKA1U5 NM_000521.3  
GGGGTCCCGAGGCTCCGGCTCGGCAGACCGGGCGGAAAGCAGCCGAGCGGCCATGGAGCT
HKR219757 ARiS049G13 pGCAP10 NM_000521.3  
GGGGCGGGAAGTCGGGTCCCGAGGCTCCGGCTCGGCAGACCGGGCGGAAAGCAGCCGAGC
HKR279394 ARiS198I02 pGCAP10 NM_000521.3  
GGTCGGGTCCCGAGGCTCCGGCTCGGCAGACCGGGCGGAAAGCANCCGAGCGGCCATGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl