Prev. |  KEGG KO K12373 > 

RIKEN DNA Bank Human Resource - HEXA

Gene ID NCBI Gene 3073 |  KEGG hsa:3073
Gene Symbol HEXA
Protein Name hexosaminidase subunit alpha
Synonyms TSD
Featured content Lysosome (human)
Ortholog resource in our bank

  HEXA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028608 IRAK071I16 pBluescriptR BC034424 NM_000520 Partial/var
HGY081456 IRAL003K16 pOTB7 BC001138 NM_000520 Partial
HGY088007 IRAL020A07 pOTB7 BC018927 NM_000520 Full
HGY089861 IRAL024K21 pOTB7 BC021030 NM_000520 Partial/var
HGY103747 IRAL059G03 pOTB7 BC084537 NM_000520 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098841 M01C047B17 pDONR221 MGC13-C09 BC018927 ENST00000268097  
HGE098889 M01C047D17 pDONR221 MGC13-C09 BC018927 ENST00000268097  
HGE098937 M01C047F17 pDONR221 MGC13-C09 BC018927 ENST00000268097  
HGE098985 M01C047H17 pDONR221 MGC13-C09 BC018927 ENST00000268097  
HGE099033 M01C047J17 pDONR221 MGC13-C09 BC018927 ENST00000268097  
HGE099081 M01C047L17 pDONR221 MGC13-C09 BC018927 ENST00000268097  
HGE099129 M01C047N17 pDONR221 MGC13-C09 BC018927 ENST00000268097  
HGE099177 M01C047P17 pDONR221 MGC13-C09 BC018927 ENST00000268097  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015853 W01A039K13 pENTR-TOPO IRAL020A07 BC018927 NM_000520  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047680 ARe19D08 pKA1U5 NM_000520.4  
GGTCTCACGTGGCCAGCCCCCTCCGAGAGGGGAGACCAGCGGGCCATGACAAGCTCCAGG
HKR048075 ARe20D03 pKA1U5 NM_000520.4  
GGGGAGACCAGCGGGCCATGACAAGCTCCAGGCTTTGGTTTTCGCTGCTGCTGGCGGCAG
HKR080805 ARf02A05 pKA1U5 NM_000520.4  
GGGGCCATGACAAGCTCCAGGCTTTGGTTTTCGCTGCTGCTGGCGGCAGCGTTCGCAGGA
HKR166084 ARi15D12 pGCAP10 NM_000520.4  
GCTCCGAGAGGGGAGACCAGCGGGCCATGACAAGCTCCAGGCTTTGGTTTTCGCTGCTGC
HKR238610 ARiS096I18 pGCAP10 NM_000520.4  
GNNNAGATCANNCGGCANTGANGANNTCNNTGCTTTGGTTTTCNNTGCTGCTGGCGGCAG
HKR264622 ARiS161J06 pGCAP10 NM_000520.4  
GCTCCNANAGGGGAGACCAGCGGGCCATGACAAGCTCCAGGCTTTGGTTTTCGCTGCTGC
HKR364459 RBd11C11 pGCAP10 NM_000520.4  
GAGCCCCCTCCGAGAGGGGAGACCAGCGGGCCATGACAAGCTCCAGGCTTTGGTTTTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl