DNA Bank Top |  KEGG KO K19001 > 

RIKEN DNA Bank Human Resource - HELLS

Gene ID NCBI Gene 3070 |  KEGG hsa:3070
Gene Symbol HELLS
Protein Name helicase, lymphoid specific
Synonyms ICF4|LSH|Nbla10143|PASG|SMARCA6

Link

Ortholog resource in our bank

  HELLS

External database

human HELLS

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB17381 HELLS px330 Expression vector of guide RNA for targeting human HELLS exon 19.    
RDB17377 p3XFLAG-HELLS Q699R Expression vector of human HELLS mutant, Q699R.    
RDB17376 p3XFLAG-HELLS WT Expression vector of human HELLS wild-type.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009077 IRAK022L13 pCMV-SPORT6 BC015477 NM_018063 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR428216 RBdS070I24 pGCAP10 NM_018063.3  
GGATTTGGCTAGAAGGCTGGGCCGGCAGCGGTTGTGAGGAGTTAGCTCGCGGCATTGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl