Prev. | 

RIKEN DNA Bank Human Resource - HDLBP

Gene ID NCBI Gene 3069 |  KEGG hsa:3069
Gene Symbol HDLBP
Protein Name high density lipoprotein binding protein
Synonyms HBP|PRO2900|VGL
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04798 SEREX clone NGO-Pr-151 5' (ID 2492); NGO-Pr-151 3' (ID 2493) #1 SEREX clone NGO-Pr-151 5' (ID 2492); NGO-Pr-151 3' (ID 2493) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX032814 IRAK082A14 pCMV-SPORT6 BC038965 NM_203346 Partial/var
HGY083491 IRAL008M03 pOTB7 BC001179 NM_203346 Full
HGY090365 IRAL025P05 pOTB7 BC014305 NM_203346 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043345 ARe08G01 pKA1U5 NM_005336.3  
GAAGCGTAGCCTCTTCTCCTTTACCAAGATGGCGGCTTGTCCCTGNTTTCGCCACAGTTC
HKR046003 ARe15A03 pKA1U5 NM_005336.3  
GGCNTCNGAGCGCTCCCGGCTTCTCCCGCGCGNGGGGCNAGTAAGCCAGCGGCAGGACCA
HKR059345 ARe48G01 pKA1U5 NM_005336.3  
GATATAGAGGCCTGGGGGTGGGGGGGGAGGNCCCCCTTAGCCTCTTCTCCTTTACCAAGA
HKR060574 ARe51H06 pKA1U5 NM_005336.3  
GAAGCGTAGCCTCTTCTCCTTTACCAAGATGGCGGCTTGTCCCTGTTTCGCCACAGTTCC
HKR260205 ARiS150I13 pGCAP10 NM_005336.3  
GATCNANTCGGGCGTCCCTCCCCGGGGACGTGGCCTTCCTGTGCCCGGGCTGGGGNNNNT
HKR336580 RBb41H12 pGCAP1 NM_005336.3  
TGATATATAGAGGCTGGGGGTGGGGGGGGAGGTCAAGCGTAGCCTCTTCTCCTTTACCAA
HKR360412 RBd01A12 pGCAP10 NM_005336.3  
GCTCTTCTCCTTTACCAAGATGGCGGCTTGTCCCTGTTTCGCCACAGTTCCTACCTTATG
HKR388410 RBd71A10 pGCAP10 NM_005336.3  
GGGGGACGTGGCCTTCCTGTGCCCGGGCTGGGGCCCGCCGCCCCGCGGGGGAGGGCGGAG
HKR441801 RBdS104I09 pGCAP10 NM_005336.3  
GCTCGGANCGTCCCGGCTTCTCCCGCGCGGGGGGCGAGTAAGCCAGCGGCAGGACCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl