Prev. |  KEGG KO K16641 > 

RIKEN DNA Bank Human Resource - HDGF

Gene ID NCBI Gene 3068 |  KEGG hsa:3068
Gene Symbol HDGF
Protein Name heparin binding growth factor
Synonyms HMG1L2
Ortholog resource in our bank

  HDGF

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01493 Human HDGF Plasmid clone of human HDGF cDNA

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091238 IRAL028B14 pOTB7 BC018991 NM_004494 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001011 W01A002I19 pENTR-TOPO IRAL028B14 BC018991 NM_004494  
HGE001015 W01A002I23 pENTR-TOPO IRAL028B14 BC018991 NM_004494  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042836 ARe07B12 pKA1U5 NM_004494.2  
GAGCCTTGCCCCGATCCGCGCCCGCCCCGTCCGTGCGGCGCGCGGGCGGAGACNCCGTGG
HKR078547 ARe96G03 pKA1U5 NM_004494.2  
GATCCGCGCCCGCCCCGTCCGTGCGGCGCGCGGGCGGAGACGCCGTGGCCGCGCCGGAGC
HKR163656 ARi09C08 pGCAP10 NM_004494.2  
GGCCCCGATCCGCGCCCGCCCCGTCCGTGCGGCGCGCGGGCGGANACGCCGTGGCCGCGC
HKR203261 ARiS008C13 pGCAP10 NM_004494.2  
GGNATTTNANACACNCNNNNCTGNNNGAGCGCGCACCCACCGCGCCGGAGCCTTGCCCCG
HKR205435 ARiS013J19 pGCAP10 NM_004494.2  
GAATTGAATTTCAAACACAAACAACTGCACAAGCGCGCACCCACCGCGCCGGAGCCTTGC
HKR247498 ARiS118M10 pGCAP10 NM_004494.2  
HKR264422 ARiS161A22 pGCAP10 NM_004494.2  
GCGTGCNNCNCGCGGGCGGANACGCCGTGGCCGCGCCGGAGCTCGGGCCGGGGGCCACCA
HKR324482 RBb11D10 pKA1U5 NM_004494.2  
HKR368524 RBd21F04 pGCAP10 NM_004494.2  
GAACTGCTCGAGCGCGCACCCACCGCGCCGGAGCCTTGCCCCGATCCGCGCCCGCCCCGT
HKR372810 RBd32A10 pGCAP10 NM_004494.2  
GAAACACAAACAACTGCACGAGCGCGCACCCACCGCGCCGGAGCCTTGCCCCGATCCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl