DNA Bank Top |  KEGG KO K06067 > 

RIKEN DNA Bank Human Resource - HDAC2

Gene ID NCBI Gene 3066 |  KEGG hsa:3066
Gene Symbol HDAC2
Protein Name histone deacetylase 2
Synonyms HD2|KDAC2|RPD3|YAF1
Featured content Notch signaling pathway (human)
Featured content Huntington disease - human

Link

Ortholog resource in our bank

  HDAC2


External database

human HDAC2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB13163 HDAC2-pcDNA3.1 myc-His Expression plasmid of human HDAC2    
RDB03609 pAxCALNLhHDAC2 (forward) Shuttle vector to generate rAd harboring human HDAC2 (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046076 ARe15D04 pKA1U5 NM_001527.2 done
GGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCNGTTCCATCTGCCGGGTGGTACCGAGC
HKR053302 ARe33E06 pKA1U5 NM_001527.2  
GCCCCTCCTCGCGAGTTGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGC
HKR071705 ARe79E09 pKA1U5 NM_001527.2  
GGCGAGTTGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGCCGGGTGGTA
HKR072145 ARe80G01 pKA1U5 NM_001527.2  
GGCGAGTTGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGCCGGGTGGTA
HKR238722 ARiS096N10 pGCAP10 NM_001527.2  
GCCCCTCCTCGCGAGTTGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGC
HKR333699 RBb34E03 pGCAP1 NM_001527.2  
GGCGCGGCCTCCTGAGGTGGTTTGGTGGCCCCCTCCTCGCGAGTTGGTGCCGCTGCCACC
HKR361654 RBd04C06 pGCAP10 NM_001527.2  
GGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGCCGGGTGGTACCGAGCCTTC
HKR392406 RBd81A06 pGCAP10 NM_001527.2  
GGATTCCGAGCTTTCGGCACCTCTGCCGGGTGGTACCGAGCCTTCCCGGCGCCCCCTCCT
HKR441829 RBdS104J13 pGCAP10 NM_001527.2  
GCCCTCCTCGCGAGTTGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl