Prev. |  KEGG KO K06067 > 

RIKEN DNA Bank Human Resource - HDAC2

Gene ID NCBI Gene 3066 |  KEGG hsa:3066
Gene Symbol HDAC2
Protein Name histone deacetylase 2
Synonyms HD2|RPD3|YAF1
Ortholog resources KEGG ortholog (KEGG orthology K06067) in the DNA Bank
Featured content Notch signaling pathway (human)
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03609 pAxCALNLhHDAC2 (forward) Shuttle vector to generate rAd harboring human HDAC2 (forward)
RDB13163 HDAC2-pcDNA3.1 myc-His Expression plasmid of human HDAC2

RDB_org_190226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046076 ARe15D04 pKA1U5 NM_001527.2  
GGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCNGTTCCATCTGCCGGGTGGTACCGAGC
HKR053302 ARe33E06 pKA1U5 NM_001527.2  
GCCCCTCCTCGCGAGTTGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGC
HKR071705 ARe79E09 pKA1U5 NM_001527.2  
GGCGAGTTGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGCCGGGTGGTA
HKR072145 ARe80G01 pKA1U5 NM_001527.2  
GGCGAGTTGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGCCGGGTGGTA
HKR238722 ARiS096N10 pGCAP10 NM_001527.2  
GCCCCTCCTCGCGAGTTGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGC
HKR333699 RBb34E03 pGCAP1 NM_001527.2  
GGCGCGGCCTCCTGAGGTGGTTTGGTGGCCCCCTCCTCGCGAGTTGGTGCCGCTGCCACC
HKR361654 RBd04C06 pGCAP10 NM_001527.2  
GGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGCCGGGTGGTACCGAGCCTTC
HKR392406 RBd81A06 pGCAP10 NM_001527.2  
GGATTCCGAGCTTTCGGCACCTCTGCCGGGTGGTACCGAGCCTTCCCGGCGCCCCCTCCT
HKR441829 RBdS104J13 pGCAP10 NM_001527.2  
GCCCTCCTCGCGAGTTGGTGCCGCTGCCACCTCCGATTCCGAGCTTTCGGCACCTCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.09.10

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl