Prev. |  KEGG KO K06067 > 

RIKEN DNA Bank Human Resource - HDAC1

Gene ID NCBI Gene 3065 |  KEGG hsa:3065
Gene Symbol HDAC1
Protein Name histone deacetylase 1
Synonyms GON-10|HD1|RPD3|RPD3L1
Ortholog resources KEGG ortholog (KEGG orthology K06067) in the DNA Bank
Featured content Notch signaling pathway (human)
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02601 pAxCAhHDAC1 (forward) Shuttle vector to produce rAd expressing human histone deacetylase 1 (HDAC1)
RDB02602 pAxCAhHDAC1 (reverse) Shuttle vector to generate rAd harboring human histone deacetylase 1 (HDAC1) cDNA
RDB02704 pAxCALNLhHDAC1 (forward) Shuttle vector to produce rAd expressing human HDAC1
RDB02705 pAxCALNLhHDAC1 (reverse) Shuttle vector to produce rAd expressing human HDAC1
RDB05221 pAxCALNLhHDAC1(forward) Shuttle vector to generate rAd expressing human HDAC1
RDB07484 pGL4-phHDAC1 Promoter collection, Human HDAC1 promoter
RDB13162 HDAC1-pcDNA3.1 myc-His Expression plasmid of human HDAC1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080457 IRAL001C09 pOTB7 BC000301 NM_004964 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002358 W01A005O22 pENTR-TOPO IRAL001C09 BC000301 NM_004964  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059351 ARe48G07 pKA1U5 NM_004964.2  
GGGACGCTGAGCGGAGCCGCGGNCGGGAGGGCCGATNGACCGACTGACNGTAGGGACGGG
HKR346502 RBb66E06 pGCAP1 NM_004964.2  
AGCCCCTCCCCCCTGGGTCGGACGCTGAGCGGAGCCGCGGGCGGGAGGGCGGACGGACCG
HKR370151 RBd25G07 pGCAP10 NM_004964.2  
GGGCTGATCGGANCCTCCGGCGTCTGGGGTTTCGGACCGACTGACGGTAGGGACNGGAGG
HKR378458 RBd46C10 pGCAP10 NM_004964.2  
GGGACCGACTGACGGTAGGGACGGGAGGCGAGCAAGATGGCGCAGACGCAGGGCACCCGG
HKR388880 RBd72D08 pGCAP10 NM_004964.2  
GGGACCGACTGACGGTAGGGACGGGAGGCGAGCAAGATGGCGCAGACGCAGGGCACCCGG
HKR405229 RBdS013B05 pGCAP10 NM_004964.2  
GGGGAGGGCGGACGGACCGACTGACGGTAGGGACGGGAGGCGAGCAAGATGGCGCAGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.09.10

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl