Prev. |  KEGG KO K13827 > 

RIKEN DNA Bank Human Resource - HBQ1

Gene ID NCBI Gene 3049 |  KEGG hsa:3049
Gene Symbol HBQ1
Protein Name hemoglobin subunit theta 1
Synonyms HBQ
Ortholog resource in our bank

  HBQ1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY099514 IRAL048N02 pDNR-LIB BC056686 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096848 M01C042B24 pDONR221 MGC10-H12 BC056686 NM_005331  
HGE096896 M01C042D24 pDONR221 MGC10-H12 BC056686 NM_005331  
HGE096944 M01C042F24 pDONR221 MGC10-H12 BC056686 NM_005331  
HGE096992 M01C042H24 pDONR221 MGC10-H12 BC056686 NM_005331  
HGE097040 M01C042J24 pDONR221 MGC10-H12 BC056686 NM_005331  
HGE097088 M01C042L24 pDONR221 MGC10-H12 BC056686 NM_005331  
HGE097136 M01C042N24 pDONR221 MGC10-H12 BC056686 NM_005331  
HGE097184 M01C042P24 pDONR221 MGC10-H12 BC056686 NM_005331  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372179 RBd30H11 pGCAP10 NM_005331.3  
GGCAGGGCGCGGCGGGTTCCAGCGCGGGGATGGCGCTGTCCGCGGAGGACCGGGCGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl