Prev. |  KEGG KO K01892 > 

RIKEN DNA Bank Human Resource - HARS

Gene ID NCBI Gene 3035 |  KEGG hsa:3035
Gene Symbol HARS
Protein Name histidyl-tRNA synthetase
Synonyms CMT2W|HRS|USH3B
Ortholog resources KEGG ortholog (KEGG orthology K01892) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091184 IRAL027P24 pOTB7 BC011807 NM_002109 Full
HGY103605 IRAL059A05 pOTB7 BC080514 NM_002109 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR453073 RBdS132L09 pGCAP10 NM_002109.3  
GGGCTCAAGTGGACAGCCGGGATGGCAGAGCGTGCGGCGCTGGAGGAGCTGGTGAAACTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl