Prev. |  KEGG KO K07509 > 

RIKEN DNA Bank Human Resource - HADHB

Gene ID NCBI Gene 3032 |  KEGG hsa:3032
Gene Symbol HADHB
Protein Name hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta
Synonyms ECHB|MSTP029|MTPB|TP-BETA
Ortholog resource in our bank

  HADHB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066858 IRAK167C10 pBluescriptR BC066963 NM_000183 Partial
HGY081515 IRAL003N03 pOTB7 BC017564 NM_000183 Partial
HGY092603 IRAL031I11 pDNR-LIB BC014572 NM_000183 Partial/var
HGY094404 IRAL036A04 pDNR-LIB BC030824 NM_000183 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372900 RBd32E04 pGCAP10 NM_000183.2  
CGGCCGGCCGATGACTTGGACCTGAACCTTGCTCCGAGAGGGAGTCCTCGCGGACGTCAG
HKR375612 RBd39A12 pGCAP10 NM_000183.2  
GGGTACTTGGACCTGAACCTTGCTCCGAGAGGGAGTCCTCGCGGACGTCAGCCAAGATTC
HKR405667 RBdS014C19 pGCAP10 NM_000183.2  
GGCCTTGGTACTTGGACCTGAACCTTGCTCCGAGAGGGAGTCCTCGCGGACGTCAGCCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl