Prev. |  KEGG KO K07515 > 

RIKEN DNA Bank Human Resource - HADHA

Gene ID NCBI Gene 3030 |  KEGG hsa:3030
Gene Symbol HADHA
Protein Name hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha
Synonyms ECHA|GBP|HADH|LCEH|LCHAD|MTPA|TP-ALPHA
Ortholog resource in our bank

  HADHA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081489 IRAL003M01 pOTB7 BC009235 NM_000182 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099640 M01C049B16 pDONR221 MGC14-D08 BC009235 NM_000182  
HGE099688 M01C049D16 pDONR221 MGC14-D08 BC009235 NM_000182  
HGE099736 M01C049F16 pDONR221 MGC14-D08 BC009235 NM_000182  
HGE099784 M01C049H16 pDONR221 MGC14-D08 BC009235 NM_000182  
HGE099832 M01C049J16 pDONR221 MGC14-D08 BC009235 NM_000182  
HGE099880 M01C049L16 pDONR221 MGC14-D08 BC009235 NM_000182  
HGE099928 M01C049N16 pDONR221 MGC14-D08 BC009235 NM_000182  
HGE099976 M01C049P16 pDONR221 MGC14-D08 BC009235 NM_000182  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064082 ARe60D10 pKA1U5 NM_000182.4  
GCTCCACTGGCTGGTCCTCTTCAGCTCAAGATGGTGGCCTGCCGGGCGATTGGCATCCTC
HKR222241 ARiS055K01 pGCAP10 NM_000182.4  
GCCNCTGCTGTCCTCTTCANCTCNNGATGGTGGCCTGCCGGGCGATTGGNATCCTCAGCC
HKR235205 ARiS088A05 pGCAP10 NM_000182.4  
GACCCGTTAGAGGCGCTCTCCACTGCTGTCCTCTTCAGCTCAAGATGGTGGCCTGCCGGG
HKR247530 ARiS118N18 pGCAP10 NM_000182.4  
GGTCCTCTTCAGCTCAAGATGGTGGCCTGCCGGGCGATTGGCATCCTCAGCCGCTTTTCT
HKR260209 ARiS150I17 pGCAP10 NM_000182.4  
GAGANGTNNTNTCNNTTGCTGTCCTCTTCAGCTNAAGATGGGGGCNTGCCGGGCGATTGN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl