Prev. |  KEGG KO K01069 > 

RIKEN DNA Bank Human Resource - HAGH

Gene ID NCBI Gene 3029 |  KEGG hsa:3029
Gene Symbol HAGH
Protein Name hydroxyacylglutathione hydrolase
Synonyms GLO2|GLX2|GLXII|HAGH1
Ortholog resources KEGG ortholog (KEGG orthology K01069) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001885 IRAK004L21 pCMV-SPORT6 BC000840 NM_005326 Full
HGY084811 IRAL012A11 pOTB7 BC002627 NM_005326 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR325229 RBb13B05 pKA1U5 NM_005326.4  
GCTCGCCGCGCTGGGAGCCGCCTGCGCCCGCCGAGGCCTCGGTCCAGCCCTGCTGGGAGT
HKR333327 RBb33F07 pGCAP1 NM_005326.4  
GGTCAGCCCGGCCCGGGTCATGGTGGTGGGCCGAGGGCTGCTCGGCCGCCGCAGCCTCGC
HKR368547 RBd21G03 pGCAP10 NM_005326.4  
GAGTCCTGGGCAGCTCGGCAGTCCAGCCCGGCCCGGGTCATGGTGGTGGGCCGAGGGCTG
HKR383722 RBd59F02 pGCAP10 NM_005326.4  
GAGCCCGGCCCGGGTCATGGTGGTGGGCCGAGGGCTGCTCGGCCGCCGCAGCCTCGCCGC
HKR474920 RBdS187E24 pGCAP10 NM_005326.4  
GAGCCCGGCCCGGGTCATGGTGGTGGGCCGAGGGCTGCTCGGCCGCCGCAGCCTCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl