Prev. |  KEGG KO K08683 > 

RIKEN DNA Bank Human Resource - HSD17B10

Gene ID NCBI Gene 3028 |  KEGG hsa:3028
Gene Symbol HSD17B10
Protein Name hydroxysteroid 17-beta dehydrogenase 10
Synonyms 17b-HSD10|ABAD|CAMR|DUPXp11.22|ERAB|HADH2|HCD2|HSD10MD|MHBD|MRPP2|MRX17|MRX31|MRXS10|SCHAD|SDR5C1
Ortholog resources KEGG ortholog (KEGG orthology K08683) in the DNA Bank
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080424 IRAL001A24 pOTB7 BC000372 NM_004493 Full
HGY089006 IRAL022I14 pOTB7 BC008708 NM_001037811 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014057 W01A035C09 pENTR-TOPO IRAL001A24 BC000372 NM_004493  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR179756 ARi49G12 pGCAP10 NM_001037811.2  
GATCCCGTGGAGTGGCCGGCGACAAGATGGCAGCAGCGTGTCGGAGCGTGAAGGGCCTGG
HKR379606 RBd49A06 pGCAP10 NM_001037811.2  
GATCCCGTGGAGTGGCCGGCGACAAGATGGCAGCAGCGTGTCGGAGCGTGAAGGGCCTGG
HKR420478 RBdS051D06 pGCAP10 NM_001037811.2  
GATCCCCATCCCGTGGAGTGGCCGGCGACAAGATGGCAGCAGCGTGTCGGAGCGTGAAGG
HKR471012 RBdS177I20 pGCAP10 NM_001037811.2  
GCGTGGAGTGGCCGGCGACAAGATGGCAGCAGCGTGTCGGAGCGTGAAGGGCCTGGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl