Prev. |  KEGG KO K11253 > 

RIKEN DNA Bank Human Resource - H3F3B

Gene ID NCBI Gene 3021 |  KEGG hsa:3021
Gene Symbol H3F3B
Protein Name H3 histone family member 3B
Synonyms H3.3B
Ortholog resources KEGG ortholog (KEGG orthology K11253) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006148 IRAK015G04 pCMV-SPORT6 BC017558 NM_005324 Full
HGY081010 IRAL002I18 pOTB7 BC006497 NM_005324 Full
HGY081241 IRAL003B17 pOTB7 BC001124 NM_005324 Full
HGY084057 IRAL010C09 pOTB7 BC012813 NM_005324 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004157 W01A010G13 pENTR-TOPO IRAK015G04 BC017558 NM_005324  
HGE004209 W01A010I17 pENTR-TOPO IRAL010C09 BC006497 NM_005324  
HGE004211 W01A010I19 pENTR-TOPO IRAL010C09 BC006497 NM_005324  
HGE004213 W01A010I21 pENTR-TOPO IRAL010C09 BC006497 NM_005324  
HGE004215 W01A010I23 pENTR-TOPO IRAL010C09 BC006497 NM_005324  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042456 ARe06C08 pKA1U5 NM_005324.3  
TAGTGGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGAC
HKR055231 ARe38B07 pKA1U5 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGG
HKR056971 ARe42H03 pKA1U5 NM_005324.3  
GGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGTTGNTTTTTCGCTCGTCGACTGCGGCTC
HKR057274 ARe43D02 pKA1U5 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR062552 ARe56G08 pKA1U5 NM_005324.3  
TGGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGCNGTTGGTTTTTCGCTCGTCGACTGCGG
HKR074058 ARe85C10 pKA1U5 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR076008 ARe90A08 pKA1U5 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGG
HKR079603 ARe99A03 pKA1U5 NM_005324.3  
GGCGCANAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGATTTTTCGCTCGTCGACTGCGG
HKR079678 ARe99D06 pKA1U5 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGTTGGTTTTTCGCTCGTCGACTGCGG
HKR162570 ARi06H02 pGCAP10 NM_005324.3  
GGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGTTGGTTTTTCGCTCGTCGACTGCGGCTC
HKR175702 ARi39E06 pGCAP10 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGG
HKR180953 ARi52G09 pGCAP10 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR182406 ARi56A06 pGCAP10 NM_005324.3  
TGAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCTCT
HKR182455 ARi56C07 pGCAP10 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGTTGGTTTTTCGCTCGTCGACTGCG
HKR187283 ARi68D11 pGCAP10 NM_005324.3  
GGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGTTGGTTTTTCGCTCGTCGACTGCGGCTC
HKR205452 ARiS013K12 pGCAP10 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR235582 ARiS088P22 pGCAP10 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGTTGGTTTTTCGCTCGTCGACTGCGG
HKR243623 ARiS109A23 pGCAP10 NM_005324.3  
GGAGCGCANAGCGGTTTGGTCGTTCGTTGGGCGGTGTTGGTTTTTCGCTCGTCGACTGCG
HKR264452 ARiS161C04 pGCAP10 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGG
HKR322555 RBb06G11 pKA1U5 NM_005324.3  
TGGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGNTGGTTTTTCGCTCGTCGACTGCGG
HKR325677 RBb14D05 pKA1U5 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGG
HKR326148 RBb15G04 pKA1U5 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGNGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR327731 RBb19F11 pKA1U5 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR329674 RBb24D02 pGCAP1 NM_005324.3  
TGGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGC
HKR329752 RBb24G08 pGCAP1 NM_005324.3  
AGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCTCTTC
HKR333371 RBb33H03 pGCAP1 NM_005324.3  
GCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCT
HKR337601 RBb44A01 pGCAP1 NM_005324.3  
TGGCGCAGAAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR344572 RBb61H04 pGCAP1 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR346828 RBb67B04 pGCAP1 NM_005324.3  
AGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR346907 RBb67E11 pGCAP1 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR347697 RBb69E01 pGCAP1 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR360905 RBd02E09 pGCAP10 NM_005324.3  
GAGCGCACAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGG
HKR362033 RBd05B09 pGCAP10 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGG
HKR367684 RBd19D12 pGCAP10 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR368428 RBd21B04 pGCAP10 NM_005324.3  
GAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCTCTT
HKR373307 RBd33E11 pGCAP10 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR373724 RBd34F04 pGCAP10 NM_005324.3  
GGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCTC
HKR380526 RBd51F06 pGCAP10 NM_005324.3  
TGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR381205 RBd53A05 pGCAP10 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCNNTCGTCGACTGCGGC
HKR382900 RBd57E04 pGCAP10 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR383229 RBd58B05 pGCAP10 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCNCTCGTCGACTGCGG
HKR383253 RBd58C05 pGCAP10 NM_005324.3  
HKR383745 RBd59G01 pGCAP10 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR385276 RBd63D04 pGCAP10 NM_005324.3  
GGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCTC
HKR385731 RBd64F11 pGCAP10 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR387653 RBd69C05 pGCAP10 NM_005324.3  
GGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCTC
HKR388126 RBd70F06 pGCAP10 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR390923 RBd77F03 pGCAP10 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR393700 RBd84E04 pGCAP10 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR396427 RBd91B03 pGCAP10 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGG
HKR397204 RBd93A04 pGCAP10 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGG
HKR420551 RBdS051G07 pGCAP10 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR420638 RBdS051J22 pGCAP10 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR428337 RBdS070O01 pGCAP10 NM_005324.3  
GAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCTCTT
HKR433331 RBdS083F11 pGCAP10 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR441704 RBdS104E08 pGCAP10 NM_005324.3  
TGNAGNNNANAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCNACTGC
HKR444134 RBdS110F14 pGCAP10 NM_005324.3  
GGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCTC
HKR461685 RBdS154D13 pGCAP10 NM_005324.3  
GGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGC
HKR461896 RBdS154M08 pGCAP10 NM_005324.3  
GAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGG
HKR462548 RBdS156G04 pGCAP10 NM_005324.3  
GGAGCGCAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCG
HKR470919 RBdS177E23 pGCAP10 NM_005324.3  
GAGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCTCTT
HKR475118 RBdS187N06 pGCAP10 NM_005324.3  
AGAGCGGTTTGGTCGTTCGTTGGGCGGTGCTGGTTTTTCGCTCGTCGACTGCGGCTCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl