Prev. |  KEGG KO K11253 > 

RIKEN DNA Bank Human Resource - H3F3A

Gene ID NCBI Gene 3020 |  KEGG hsa:3020
Gene Symbol H3F3A
Protein Name H3 histone family member 3A
Synonyms H3.3A|H3F3
Ortholog resources KEGG ortholog (KEGG orthology K11253) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033104 IRAK082M16 pCMV-SPORT6 BC038989 NM_002107 Full
HGX066424 IRAK166A24 pCMV-SPORT6 BC081560 NM_002107 Full
HGX066548 IRAK166G04 pCMV-SPORT6 BC081561 NM_002107 Full/var
HGY066964 IRAK167G20 pBluescriptR BC066901 NM_002107 Full
HGY067254 IRAK168C06 pBluescriptR BC067757 NM_002107 Full
HGY096446 IRAL041B22 pDNR-LIB BC029405 NM_002107 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081223 M01C003A23 pDONR221 04-134-2_2-A12 BC029405 NM_002107  
HGE081271 M01C003C23 pDONR221 04-134-2_2-A12 BC029405 NM_002107  
HGE081319 M01C003E23 pDONR221 04-134-2_2-A12 BC029405 NM_002107  
HGE081367 M01C003G23 pDONR221 04-134-2_2-A12 BC029405 NM_002107  
HGE081415 M01C003I23 pDONR221 04-134-2_2-A12 BC029405 NM_002107  
HGE081463 M01C003K23 pDONR221 04-134-2_2-A12 BC029405 NM_002107  
HGE081511 M01C003M23 pDONR221 04-134-2_2-A12 BC029405 NM_002107  
HGE081559 M01C003O23 pDONR221 04-134-2_2-A12 BC029405 NM_002107  
HGE113648 M01C084B24 pDONR221 IMS05-H12 BC029405 NM_002107  
HGE113696 M01C084D24 pDONR221 IMS05-H12 BC029405 NM_002107  
HGE113744 M01C084F24 pDONR221 IMS05-H12 BC029405 NM_002107  
HGE113792 M01C084H24 pDONR221 IMS05-H12 BC029405 NM_002107  
HGE113840 M01C084J24 pDONR221 IMS05-H12 BC029405 NM_002107  
HGE113888 M01C084L24 pDONR221 IMS05-H12 BC029405 NM_002107  
HGE113936 M01C084N24 pDONR221 IMS05-H12 BC029405 NM_002107  
HGE113984 M01C084P24 pDONR221 IMS05-H12 BC029405 NM_002107  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE045217 W01A113A17 pENTR-TOPO IRAK167G20 BC066901 NM_002107  
HGE045219 W01A113A19 pENTR-TOPO IRAK167G20 BC066901 NM_002107  
HGE004197 W01A010I05 pENTR-TOPO IRAL041B22 BC029405 NM_002107  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045606 ARe14A06 pKA1U5 NM_002107.3  
GGCTCGCCGAGCTCCAGCCGAAGGAGAAGGGGGGTAAGTAAGGAGGTCTCTGTACCATGG
HKR068034 ARe70B10 pKA1U5 NM_002107.3  
GGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCGCCGAGCTCCAGCCG
HKR160476 ARi01D04 pGCAP10 NM_002107.3  
AATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCG
HKR180922 ARi52F02 pGCAP10 NM_002107.3  
GGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCGCCGAGCTCCAGCCGAAGGAGAA
HKR184405 ARi61A05 pGCAP10 NM_002107.3  
GCAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCT
HKR186506 ARi66E10 pGCAP10 NM_002107.3  
GTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCG
HKR264626 ARiS161J10 pGCAP10 NM_002107.3  
GAATTGNGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTC
HKR279247 ARiS198B23 pGCAP10 NM_002107.3  
HKR322054 RBb05C06 pKA1U5 NM_002107.3  
GGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCGCCGAGCTCCAGCCGAAGGAGAA
HKR322128 RBb05F08 pKA1U5 NM_002107.3  
GGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTTNGCCGAGCTCCAGCCGAAGGAGA
HKR324477 RBb11D05 pKA1U5 NM_002107.3  
GTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCG
HKR330100 RBb25E04 pGCAP1 NM_002107.3  
GAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCGCCGAGCT
HKR332850 RBb32C02 pGCAP1 NM_002107.3  
GTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCG
HKR338484 RBb46D12 pGCAP1 NM_002107.3  
HKR345607 RBb64A07 pGCAP1 NM_002107.3  
AATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCG
HKR348054 RBb70C06 pGCAP1 NM_002107.3  
TTAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCT
HKR348174 RBb70H06 pGCAP1 NM_002107.3  
AATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCG
HKR365236 RBd13B12 pGCAP10 NM_002107.3  
GAATTGNGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTC
HKR368459 RBd21C11 pGCAP10 NM_002107.3  
GAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTC
HKR370148 RBd25G04 pGCAP10 NM_002107.3  
GGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTC
HKR375355 RBd38G11 pGCAP10 NM_002107.3  
GGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTC
HKR377230 RBd43B06 pGCAP10 NM_002107.3  
GGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTC
HKR387305 RBd68E09 pGCAP10 NM_002107.3  
GTGTTCNCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCG
HKR390170 RBd75H02 pGCAP10 NM_002107.3  
GGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTC
HKR390929 RBd77F09 pGCAP10 NM_002107.3  
GAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTC
HKR395611 RBd89A11 pGCAP10 NM_002107.3  
GGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTC
HKR403004 RBdS007I12 pGCAP10 NM_002107.3  
GGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTC
HKR405377 RBdS013H09 pGCAP10 NM_002107.3  
GAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTC
HKR405426 RBdS013J10 pGCAP10 NM_002107.3  
TGAGCCGCCGCCGCGCCNCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCGCCGAGC
HKR406103 RBdS015E07 pGCAP10 NM_002107.3  
GAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTC
HKR406216 RBdS015I24 pGCAP10 NM_002107.3  
GATCTTTCAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCC
HKR409020 RBdS022J04 pGCAP10 NM_002107.3  
GGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTC
HKR430313 RBdS075N01 pGCAP10 NM_002107.3  
GAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTC
HKR432517 RBdS081E21 pGCAP10 NM_002107.3  
GCAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCT
HKR432657 RBdS081K17 pGCAP10 NM_002107.3  
GNGGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGC
HKR433348 RBdS083G04 pGCAP10 NM_002107.3  
GAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTC
HKR441607 RBdS104A07 pGCAP10 NM_002107.3  
GCTCTCGCTCGCCGAGCTCCAGCCGAAGGAGAAGGGGGGTAAGTAAGGAGGTCTCTGTAC
HKR441668 RBdS104C20 pGCAP10 NM_002107.3  
GGGCGTGTGTTGGGGGATAGCCTCGGTGTCAGCCATCTTTCAATTGTGTTCGCAGCCGCC
HKR442047 RBdS105B23 pGCAP10 NM_002107.3  
GAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTC
HKR442172 RBdS105H04 pGCAP10 NM_002107.3  
GAATTGTGTTCGCAGCCGCCGCCGCGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTC
HKR442177 RBdS105H09 pGCAP10 NM_002107.3  
GTCGCTCGCCGAGCTCCAGCCGAAGGAGAAGGGGGGTAAGTAAGGAGGTCTCTGTACCAT
HKR462491 RBdS156D19 pGCAP10 NM_002107.3  
GGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCGCCGAGCTCCAGCCGAAGGAGAA
HKR470897 RBdS177E01 pGCAP10 NM_002107.3  
GGCCGCCGTCGCTCTCCAACGCCAGCGCCGCCTCTCGCTCGCCGAGCTCCAGCCGAAGGA
HKR474995 RBdS187I03 pGCAP10 NM_002107.3  
GGCGTGTGTTGGGGGATAGCCTCGGTGTCAGCCATCTTTCAATTGTGTTCGCAGCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl