Prev. |  KEGG KO K11251 > 

RIKEN DNA Bank Human Resource - H2AFZ

Gene ID NCBI Gene 3015 |  KEGG hsa:3015
Gene Symbol H2AFZ
Protein Name H2A histone family member Z
Synonyms H2A.Z-1|H2A.z|H2A/z|H2AZ
Ortholog resources KEGG ortholog (KEGG orthology K11251) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX032939 IRAK082F19 pCMV-SPORT6 BC039005 NM_002106
HGY094168 IRAL035G24 pDNR-LIB BC018002 NM_002106 Full
HGY094269 IRAL035L05 pDNR-LIB BC020936 NM_002106 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042483 ARe06D11 pKA1U5 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR048128 ARe20F08 pKA1U5 NM_002106.3  
GGCAGTTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGA
HKR049258 ARe23C10 pKA1U5 NM_002106.3  
GGCAGTTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGA
HKR166976 ARi17H08 pGCAP10 NM_002106.3  
CGGCCGGCCGATGGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCAC
HKR172828 ARi32B04 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR172971 ARi32H03 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR173698 ARi34E02 pGCAP10 NM_002106.3  
GGGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGA
HKR175281 ARi38D09 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR182806 ARi57A06 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR185373 ARi63H05 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR186152 ARi65G08 pGCAP10 NM_002106.3  
GGCAGTTTGANCGCGGTGCGACGANNAGTANGTGGTGNNTCTCACCGTGGNCNATTANCT
HKR188124 ARi70F04 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR203512 ARiS008M24 pGCAP10 NM_002106.3  
GAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGATTA
HKR205361 ARiS013G17 pGCAP10 NM_002106.3  
TGGCAGTTTGAATCNCGGNGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGA
HKR219758 ARiS049G14 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR219807 ARiS049I15 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR235164 ARiS087P04 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR279540 ARiS198O04 pGCAP10 NM_002106.3  
GGCAGNNNGNTCGCGGNGCGACNANNGAGTAGGNGGNGGNNNNTCACCGTGGGTCCGATT
HKR320947 RBb02G03 pKA1U5 NM_002106.3  
GCGGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCG
HKR336178 RBb40H10 pGCAP1 NM_002106.3  
TGGGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCG
HKR339253 RBb48C05 pGCAP1 NM_002106.3  
AAATGTGGGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGG
HKR341697 RBb54E01 pGCAP1 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGNTGGGTCCGA
HKR347208 RBb68A08 pGCAP1 NM_002106.3  
GGCAGTTTGAATTCGCGGTGCGACGAAGGAAGTAGGTGGTGGGATCTCACCGTGGGTCCG
HKR361722 RBd04F02 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR368173 RBd20H05 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR373779 RBd34H11 pGCAP10 NM_002106.3  
TGGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGA
HKR375703 RBd39E07 pGCAP10 NM_002106.3  
GAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGATTA
HKR378004 RBd45A04 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR382102 RBd55E06 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTNNCCGTGGGTCCGAT
HKR386103 RBd65E07 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR397379 RBd93H11 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR405223 RBdS013A23 pGCAP10 NM_002106.3  
GGCCNTTTGAATCNTNNNGCCACNAANGAGTANGTGGTGGGATCTCNCCNNGGGTNCGAT
HKR416358 RBdS040O22 pGCAP10 NM_002106.3  
GAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGATTA
HKR420450 RBdS051C02 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR420460 RBdS051C12 pGCAP10 NM_002106.3  
GGGGCGGANGCNCGCGNCCNTGGCAAGCGCGCGNNGGGGGGCGAACGGGCGGGGTCGCCC
HKR430193 RBdS075I01 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR441915 RBdS104N03 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR444374 RBdS110P14 pGCAP10 NM_002106.3  
GGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGAT
HKR462601 RBdS156I09 pGCAP10 NM_002106.3  
GGgaTCTCGCGGCgGgCGgcgACgGTTGGGTGGCGCGCGCANCGCCGCTGGGGGNCGGNN
HKR471142 RBdS177O06 pGCAP10 NM_002106.3  
GGCNGTTTGAATCGCGGTGCGACNAAGGANTAGGTGGTGGGATCTCACCGTGGGTCCGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl