Prev. |  KEGG KO K11251 > 

RIKEN DNA Bank Human Resource - H2AX

Gene ID NCBI Gene 3014 |  KEGG hsa:3014
Gene Symbol H2AX
Protein Name H2A.X variant histone
Synonyms H2A.X|H2A/X|H2AFX
Ortholog resource in our bank

  H2AX

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07909 pGL4-phHIST2H2AB Promoter collection, Human H2AFX promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084546 IRAL011G02 pOTB7 BC013416 NM_002105 Full
HGY084558 IRAL011G14 pOTB7 BC004915 NM_002105 Full
HGY090847 IRAL027B23 pOTB7 BC011694 NM_002105 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE045765 W01A114G21 pENTR-TOPO IRAL011G02 BC013416 NM_002105  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164147 ARi10G03 pGCAP10 NM_002105.2  
GCTCTTCTTCGCTCGTCCGTGGGCGTCTNGTTCTAGTGTTTGAACCGCCCCGTGTCGCGG
HKR167707 ARi19E11 pGCAP10 NM_002105.2  
GAGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTC
HKR168450 ARi21C02 pGCAP10 NM_002105.2  
GAGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTC
HKR178404 ARi46A04 pGCAP10 NM_002105.2  
GGACAGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCG
HKR188427 ARi71B03 pGCAP10 NM_002105.2  
AGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTCT
HKR248833 ARiS122B09 pGCAP10 NM_002105.2  
GAGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTC
HKR276507 ARiS191E11 pGCAP10 NM_002105.2  
CGGCCGGCCGATTGGGACAGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCC
HKR279435 ARiS198J19 pGCAP10 NM_002105.2  
TGAGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGT
HKR381655 RBd54C07 pGCAP10 NM_002105.2  
NNNTTTGAGCANNTNNNCTGCGGCGGGCGTCTGTTCTAGTGTTTGANCCNTCNTGCTTCA
HKR386853 RBd67C05 pGCAP10 NM_002105.2  
GAGNNNTTNCACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTC
HKR386897 RBd67E01 pGCAP10 NM_002105.2  
GAGCCNTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTC
HKR387234 RBd68B10 pGCAP10 NM_002105.2  
GACCCCNTNTANNCTGCGGCGGGCGTCTGTTCTANTGTTTGAGCCGTCGTGCTTCANCGG
HKR388027 RBd70B03 pGCAP10 NM_002105.2  
GAGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTC
HKR394854 RBd87C06 pGCAP10 NM_002105.2  
GAGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTC
HKR409001 RBdS022I09 pGCAP10 NM_002105.2  
AGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTCT
HKR432520 RBdS081E24 pGCAP10 NM_002105.2  
GAGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTC
HKR471121 RBdS177N09 pGCAP10 NM_002105.2  
GAGCAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl