Prev. |  KEGG KO K11275 > 

RIKEN DNA Bank Human Resource - H1-2

Gene ID NCBI Gene 3006 |  KEGG hsa:3006
Gene Symbol H1-2
Protein Name H1.2 linker histone, cluster member
Synonyms H1.2|H1C|H1F2|H1s-1|HIST1H1C
Ortholog resources KEGG ortholog (KEGG orthology K11275) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084909 IRAL012E13 pOTB7 BC002649 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000532 W01A001F12 pENTR-TOPO IRAL012E13 BC002649 -  

♦ W series clone contains a stop codon.

GNP_entry_W01A_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR165636 ARi14B12 pGCAP10 NM_005319.3 done
GGCTTCATCGGCGCTTTGCCACTTGTACCCGAGTTTTTGATTCTCAACATGTCCGAGACT
HKR361209 RBd03A09 pGCAP10 NM_005319.3  
GATCGGCGCTTTGCCACTTGTACCCGAGTTTTTGATTCTCAACATGTCCGAGACTGCTCC
HKR369773 RBd24H05 pGCAP10 NM_005319.3  
GATCGGCGCTTTGCCACTTGTACCCGAGTTTTTGATTCTCAACATGTCCGAGACTGCTCC
HKR383284 RBd58D12 pGCAP10 NM_005319.3  
GATCGGCGCTTTGCCACTTGTACCCGAGTTTTTGATTCTCAACATGTCCGAGACTGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl