Prev. |  KEGG KO K11275 > 

RIKEN DNA Bank Human Resource - H1F0

Gene ID NCBI Gene 3005 |  KEGG hsa:3005
Gene Symbol H1F0
Protein Name H1 histone family member 0
Synonyms H10|H1FV
Ortholog resources KEGG ortholog (KEGG orthology K11275) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001245 IRAK003B21 pCMV-SPORT6 BC000145 NM_005318 Full
HGX020199 IRAK050I07 pCMV-SPORT6 BC029046 NM_005318 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021309 W01A053E13 pENTR-TOPO IRAK003B21 BC000145 NM_005318  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056521 ARe41F01 pKA1U5 NM_005318.3  
GAGACGCGGAGCTGGGAAAAGGGAGGCAGAGGAGGCGGAGGCAGAGGCAGAGGCAGAGCC
HKR066946 ARe67G02 pKA1U5 NM_005318.3  
GAGACGCGGAGCTGGGAAAAGGGAGGCAGAGGAGGCGGAGGCAGAGGCAGAGGCAGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl