Prev. |  KEGG KO K00750 > 

RIKEN DNA Bank Human Resource - GYG1

Gene ID NCBI Gene 2992 |  KEGG hsa:2992
Gene Symbol GYG1
Protein Name glycogenin 1
Synonyms GSD15|GYG
Ortholog resources KEGG ortholog (KEGG orthology K00750) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019439 IRAK048J23 pBluescriptR BC031096 NM_004130 Partial/var
HGY083049 IRAL007K09 pOTB7 BC000033 NM_004130 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049297 ARe23E01 pKA1U5 NM_004130.2  
GAGCCGCAGCCTAGCCCCGAGGGAGGGAGGAGGAGCCGAGGGAGACGCGGGACCCGGAGC
HKR184858 ARi62C10 pGCAP10 NM_004130.2  
GCCCCGCCGTGCCTCCTCGCTGGCCGCGCTCCCTCCNGGTGCCGGCTTCTCTGAGTCACC
HKR205494 ARiS013M06 pGCAP10 NM_004130.2  
GCCCCGCCGTGCCTCCTCGCTGGCCGCGCTCCCTCCCGGTGCCGGCTTCTCTGAGTCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.03.05

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl