Prev. |  KEGG KO K00942 > 

RIKEN DNA Bank Human Resource - GUK1

Gene ID NCBI Gene 2987 |  KEGG hsa:2987
Gene Symbol GUK1
Protein Name guanylate kinase 1
Synonyms GMK
Ortholog resources KEGG ortholog (KEGG orthology K00942) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080919 IRAL002E23 pOTB7 BC009914 NM_000858 Full
HGY086175 IRAL015H07 pOTB7 BC006249 NM_000858 Full
HGY089731 IRAL024F11 pOTB7 BC007369 NM_000858 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047778 ARe19H10 pKA1U5 NM_000858.4  
GCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTNGCTGCGGCCGCCCTGGGCCGGGCCCCA
HKR051707 ARe29E11 pKA1U5 NM_000858.4  
GGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCG
HKR052459 ARe31C11 pKA1U5 NM_000858.4  
NTCCNGCTANGTATGCTGNNGNCNNNGCTANNCGGCCCTGACGTGCGTCCGCTNTNGCGT
HKR182056 ARi55C08 pGCAP10 NM_000858.4  
CGGCCGGCCGATGGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGG
HKR187352 ARi68G08 pGCAP10 NM_000858.4  
GGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGC
HKR218212 ARiS045I20 pGCAP10 NM_000858.4  
GCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACC
HKR260054 ARiS150C06 pGCAP10 NM_000858.4  
GGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCG
HKR264771 ARiS161P11 pGCAP10 NM_000858.4  
GAGTGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGC
HKR277873 ARiS194L09 pGCAP10 NM_000858.4  
GGGATGCTNNGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCG
HKR328148 RBb20G04 pKA1U5 NM_000858.4  
GGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCCCCNTTAAGGCCGGGCTGGCTGCGGCCG
HKR331611 RBb29A11 pGCAP1 NM_000858.4  
GAGTCCAGCAGACAGACCCACCCCAGGCTGACTACAGAGGCTGCACCTCAGCAAACAGGC
HKR334002 RBb35A02 pGCAP1 NM_000858.4  
GGTTCAGTGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTTGGCCGGGCTGGCT
HKR344036 RBb60B12 pGCAP1 NM_000858.4  
GGCTGTCACGTAGGTTCAGTGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTGG
HKR344553 RBb61G09 pGCAP1 NM_000858.4  
GGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGC
HKR346572 RBb66H04 pGCAP1 NM_000858.4  
GGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGG
HKR365607 RBd14A07 pGCAP10 NM_000858.4  
GGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCGGACG
HKR367225 RBd18B01 pGCAP10 NM_000858.4  
GGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGC
HKR375283 RBd38D11 pGCAP10 NM_000858.4  
GGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGC
HKR381683 RBd54D11 pGCAP10 NM_000858.4  
GATGCTGCGGNGCCCGNTGGCNNGNCTGGNNNNGGNCGCCCTGGGNCGGGCCCCNTCNGA
HKR405309 RBdS013E13 pGCAP10 NM_000858.4  
GATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCGGA
HKR406027 RBdS015B03 pGCAP10 NM_000858.4  
GGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGC
HKR408867 RBdS022C19 pGCAP10 NM_000858.4  
GGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGC
HKR428092 RBdS070D20 pGCAP10 NM_000858.4  
GGGGCCGGTGCGGCGCTGTCACGTANGTTCAGTGGGCGGAAGAGGTGGCCCCGGATGCTG
HKR433363 RBdS083G19 pGCAP10 NM_000858.4  
GGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGC
HKR441805 RBdS104I13 pGCAP10 NM_000858.4  
GGGGCGGAAGAGGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGC
HKR453053 RBdS132K13 pGCAP10 NM_000858.4  
GAGTCCAGCAGACAGACCCACCCCAGGCTGACTACAGAGGCTGCACCTCAGCAAACAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl