Prev. |  KEGG KO K15199 > 

RIKEN DNA Bank Human Resource - GTF3C1

Gene ID NCBI Gene 2975 |  KEGG hsa:2975
Gene Symbol GTF3C1
Protein Name general transcription factor IIIC subunit 1
Synonyms TFIIIC|TFIIIC220|TFIIICalpha
Ortholog resource in our bank

  GTF3C1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020962 IRAK052G18 pCMV-SPORT6 BC044857 NM_001520 Partial/var
HGX046248 IRAK115K08 pCMV-SPORT6 BC052642 NM_001520 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235002 ARiS087I10 pGCAP10 NM_001520.3  
TGGGGCGCCTCCGACTGAAGTACCAATGGACGCGCTGGAGTCGTTGTTGGACGAAGTCNC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl