Prev. |  KEGG KO K15196 > 

RIKEN DNA Bank Human Resource - BRF1

Gene ID NCBI Gene 2972 |  KEGG hsa:2972
Gene Symbol BRF1
Protein Name BRF1 RNA polymerase III transcription initiation factor subunit
Synonyms BRF|BRF-1|CFDS|GTF3B|HEL-S-76p|TAF3B2|TAF3C|TAFIII90|TF3B90|TFIIIB90|hBRF
Ortholog resource in our bank

  BRF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066412 IRAK166A12 pCMV-SPORT6 BC071637 NM_145685 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053753 ARe34G09 pKA1U5 NM_001519.2  
TGCTGGGCGGCTGGGCCTGGGCGGGCGGCGCGGGCTGCTCCGGAGGCTCGGGTGGCTTGA
HKR342830 RBb57B06 pGCAP1 NM_001519.2  
GAGTCCTCGGCTGCGCTCACCGGTAGGCCCCGCTCGGGTTCCGCCGAAGCCCAGCCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl