Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GTF3A

Gene ID (NCBI) 2971
Gene Symbol GTF3A
Protein Name general transcription factor IIIA
Synonyms AP2|TFIIIA
Databases KEGG hsa:2971 |  NCBI Gene 2971
Featured content Ortholog resources in the DNA Bank (KEGG orthology K09191)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR260024 ARiS150A24 pGCAP10 NM_002097.2  
GAGTGTGcCGGCgCCGCGCGAAGGTTCAGCAGGGAGCCGTGGGCCGGGCGCGCCGGTTCC
HKR388928 RBd72F08 pGCAP10 NM_002097.2  
GGCAGCGCGCCTGGCCCTGGGCTTGGAGGCGCCGGCGCCCTGGATCCGCCGGCCGTGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl