Prev. | 

RIKEN DNA Bank Human Resource - GTF2IP1

Gene ID NCBI Gene 2970 |  KEGG hsa:2970
Gene Symbol GTF2IP1
Protein Name general transcription factor IIi pseudogene 1
Synonyms WBSCR7
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066107 ARe65E11 pKA1U5 NR_002206.2  
GGCTCGGCCCCTCGGCTGCTGCTCCGCCGGCGCTGCCTCCCTCGCCCCGCGGCTCCCCCT
HKR403073 RBdS007L09 pGCAP10 NR_002206.2  
GACAGCGAACACCAGCTGCTCCCCGCGCCGGGCGCCGCGCGCCGCTGCTCCGCCGCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl