Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GTF2H4

Gene ID (NCBI) 2968
Gene Symbol GTF2H4
Protein Name general transcription factor IIH, polypeptide 4, 52kDa
Synonyms P52|TFB2|TFIIH
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03144)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085305 IRAL013E09 pOTB7 BC004935 NM_001517 Full
HGY089628 IRAL024B04 pOTB7 BC016302 NM_001517 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE032220 W01A080J04 pENTR-TOPO IRAL013E09 BC004935 NM_001517  
HGE032226 W01A080J10 pENTR-TOPO IRAL013E09 BC004935 NM_001517  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR332147 RBb30G03 pGCAP1 NM_001517.4  
GGCCCGGAGAGTGCAGCGTCTATTCTCATCCTCTTCACTTTTCCACTCCTCCCCTTACCT
HKR341681 RBb54D09 pGCAP1 NM_001517.4  
TGTTTTACCTCCCTTCTCTTCTGAATTCTCCATTCTGGGCTCTTGCCTGTGAAATCTTTC
HKR396054 RBd90C06 pGCAP10 NM_001517.4  
GACTCCTCCCCTTACCTCCCTTCTCTTCTGAATTCTCCATTCTGGGCTCTTGCCTGTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.23

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl