Prev. |  KEGG KO K03143 > 

RIKEN DNA Bank Human Resource - GTF2H3

Gene ID NCBI Gene 2967 |  KEGG hsa:2967
Gene Symbol GTF2H3
Protein Name general transcription factor IIH subunit 3
Synonyms BTF2|P34|TFB4|TFIIH
Featured content DNA repair (human)
Ortholog resource in our bank

  GTF2H3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032986 IRAK082H18 pCMV-SPORT6 BC039726 NM_001516 Partial
HGX042891 IRAK107D19 pCMV-SPORT6 BC047868 NM_001516 Partial
HGX056169 IRAK140H01 pCMV-SPORT6 BC065250 NM_001516 Full
HGY096696 IRAL041M08 pDNR-LIB BC031030 NM_001516 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE011217 W01A028A17 pENTR-TOPO IRAK140H01 BC065250 NM_001516  
HGE011219 W01A028A19 pENTR-TOPO IRAK140H01 BC065250 NM_001516  
HGE011223 W01A028A23 pENTR-TOPO IRAK140H01 BC065250 NM_001516  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066856 ARe67C08 pKA1U5 NM_001516.3  
GGACCACCACTTGCCTCTGCGCTGAGGTGCTGGGACAGCCATGGCTTTCAGACGAAGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl