Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GTF2H2

Gene ID (NCBI) 2966
Gene Symbol GTF2H2
Protein Name general transcription factor IIH subunit 2
Synonyms BTF2|BTF2P44|T-BTF2P44|TFIIH|p44
Databases KEGG hsa:2966 |  NCBI Gene 2966
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03142)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR015751 ARa39G07 pKA1U5 NM_001515.3  
GGTCCTTCTAGCGGCGCCGGTGAGTCCGCGTGTGGAAGTCTGTGAGGCGCAGAGGTGGGG
HKR420622 RBdS051J06 pGCAP10 NM_001515.3  
GGAGTCCGCGTGTGGAAGTCTGTGAGGCGCAGAGGTGGGGCAGGCCGTCTGGCTAGCTAG
HKR452861 RBdS132C13 pGCAP10 NM_001515.3  
TGGAGAGTCCTTCTAGCGGCGCCGATTATTGAATAATAAAATACAGTTTTGAAAAAAATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl