Prev. |  KEGG KO K03138 > 

RIKEN DNA Bank Human Resource - GTF2F1

Gene ID NCBI Gene 2962 |  KEGG hsa:2962
Gene Symbol GTF2F1
Protein Name general transcription factor IIF subunit 1
Synonyms BTF4|RAP74|TF2F1|TFIIF
Ortholog resources KEGG ortholog (KEGG orthology K03138) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082661 IRAL006K21 pOTB7 BC000120 NM_002096 Full/var
HGY084158 IRAL010G14 pOTB7 BC013007 NM_002096 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002409 W01A006A09 pENTR-TOPO IRAL010G14 BC013007 NM_002096  
HGE002411 W01A006A11 pENTR-TOPO IRAL010G14 BC013007 NM_002096  
HGE002415 W01A006A15 pENTR-TOPO IRAL010G14 BC013007 NM_002096  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR184480 ARi61D08 pGCAP10 NM_002096.2  
GACCTTTTCCCAGCGCCAGAGGCGCCTAGGGTTGGGGTCCTCGCTCAGGCACAGAGACCC
HKR187233 ARi68B09 pGCAP10 NM_002096.2  
GACCTTTTCCCAGCGCCAGAGGCGCCTAGGGTTGGGGTCCTCGCTCAGGCACAGAGACCC
HKR416015 RBdS040A15 pGCAP10 NM_002096.2  
GCTCTTCCGGTTACCTTTTCCCAGCGCCAGAGGCGCCTAGGGTTGGGGTCCTCGCTCAGG
HKR433577 RBdS083P17 pGCAP10 NM_002096.2  
GACCTTTTCCCAGCGCCAGAGGCGCCTAGGGTTGGGGTCCTCGCTCAGGCACAGAGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl