Prev. |  KEGG KO K03137 > 

RIKEN DNA Bank Human Resource - GTF2E2

Gene ID NCBI Gene 2961 |  KEGG hsa:2961
Gene Symbol GTF2E2
Protein Name general transcription factor IIE subunit 2
Synonyms FE|TF2E2|TFIIE-B|TTD6
Ortholog resources KEGG ortholog (KEGG orthology K03137) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090249 IRAL025K09 pOTB7 BC030572 NM_002095 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000932 W01A002F12 pENTR-TOPO IRAL025K09 BC030572 NM_002095  
HGE000936 W01A002F16 pENTR-TOPO IRAL025K09 BC030572 NM_002095  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061282 ARe53D10 pKA1U5 NM_002095.4  
GACTGAGCTCCTAGCACCCGATCGGGAAGTGGCGGGCGGAGTCCCGGGTCCAGTCGCCGC
HKR328575 RBb21H07 pKA1U5 NM_002095.4  
GGGGCGTGCGCTGCGGGCAGGCGGGGGCGCTGACGAGAAGCAGGAAGAGGGTGCAGTGCC
HKR369610 RBd24A10 pGCAP10 NM_002095.4  
GATGCGAGGGAGTCGAGGGGGGCGCTGACGAATGGCGTGAATAGGGAGCAATGCCGGCCT
HKR433236 RBdS083B12 pGCAP10 NM_002095.4  
GGGAGTCCCGGGTCCAGTCGCCGCCTCAGCTACCGCCGCTGCCGCCGCCGCCGCCGCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl