Prev. |  KEGG KO K03123 > 

RIKEN DNA Bank Human Resource - GTF2A2

Gene ID NCBI Gene 2958 |  KEGG hsa:2958
Gene Symbol GTF2A2
Protein Name general transcription factor IIA subunit 2
Synonyms HsT18745|T18745|TF2A2|TFIIA|TFIIA-12|TFIIA-gamma|TFIIAS
Ortholog resources KEGG ortholog (KEGG orthology K03123) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080401 IRAL001A01 pOTB7 BC000287 NM_004492 Full
HGY083699 IRAL009E03 pOTB7 BC001919 NM_004492 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000517 W01A001E21 pENTR-TOPO IRAL001A01 BC000287 NM_004492  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR182875 ARi57D03 pGCAP10 NM_004492.2  
GGTTCTGCGGGTTCTGCGGCGGCTGGAGAGGTGGTCGGAGAACGGGGAACCTCCTGCCGG
HKR247365 ARiS118G21 pGCAP10 NM_004492.2  
GGGTGGTCGGAGAAGTAGGAACCTCCTGCCGGGCTCGTGGCGGCTTCTGTCCGCTCCGCG
HKR277840 ARiS194J24 pGCAP10 NM_004492.2  
GGGAGAANTAGGAACCTCCTGCCGGGCTCGTGGCGGCTTCTGTCCGCTCCGCGGCGGGAA
HKR320435 RBb01B11 pKA1U5 NM_004492.2  
GTCAGTTCTGCGGTTTCTGCGGCGGCTGGAGAGGTGGTCGGAGAAGTAGGAACCTCCTGC
HKR327279 RBb18D07 pKA1U5 NM_004492.2  
GTCAGTTCTGCGGTTTCTGCGGCGGCTGGAGAGGTGGTCGGAGAAGTAGGAACCTCCTGC
HKR330457 RBb26C09 pGCAP1 NM_004492.2  
HKR334170 RBb35H02 pGCAP1 NM_004492.2  
GGGTTTCTGCGGCGGCTGGAGAGGTGGTCGGAGAAGTAGGAACCTCCTGCCGGGCTCGTG
HKR461814 RBdS154I22 pGCAP10 NM_004492.2  
GAGCACTTCCGGGTCGTCAGCTCAGTTCTGCGGTTTCTGCGGCGGCTGGAGAGGTGGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl