Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MSH6

Gene ID (NCBI) 2956
Gene Symbol MSH6
Protein Name mutS homolog 6
Synonyms GTBP|GTMBP|HNPCC5|HSAP|p160
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08737)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02091 GTBP-ALT-Full cDNA clone of alternatively spliced GTBP transcript
RDB02090 GTBP-Full (human) Plasmid clone of human GTBP

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY066810 IRAK167A10 pBluescriptR BC071594 NM_000179 Full/var
HGY085502 IRAL013M14 pOTB7 BC004246 NM_000179 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR276735 ARiS191N23 pGCAP10 NM_000179.2  
GAGATTTCCCGCCAGCAGGAGCCGCGCGGTAGATGCGGTGCTTTTAGGAGCTCCGTCCGA
HKR372429 RBd31B05 pGCAP10 NM_000179.2  
GGCTTTTTAGGAGCTCCGTCCGACAGAACGGTTGGGCCTTGCCGGCTGTCGGTATGTCGC
HKR390056 RBd75C08 pGCAP10 NM_000179.2  
GGCTTTTAGGAGCTCCGTCCGACAGAACGGTTGGGCCTTGCCGGCTGTCGGTATGTCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl