Prev. |  KEGG KO K00799 > 

RIKEN DNA Bank Human Resource - GSTM1

Gene ID NCBI Gene 2944 |  KEGG hsa:2944
Gene Symbol GSTM1
Protein Name glutathione S-transferase mu 1
Synonyms GST1|GSTM1-1|GSTM1a-1a|GSTM1b-1b|GTH4|GTM1|H-B|MU|MU-1
Ortholog resource in our bank

  GSTM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013325 IRAK033F05 pBluescriptR BC024005 NM_146421 Full
HGX031782 IRAK079H14 pCMV-SPORT6 BC036805 NM_000561 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057211 ARe43A11 pKA1U5 NM_000561.3  
GCTCCGGAGCTCTTATACTCTGAGCCCTGCTCGGTTTAGGCCTGTCTGCGGAATCCGCAC
HKR164474 ARi11D02 pGCAP10 NM_000561.3  
GCTGTCTGCGGAATCCGCACCAACCAGCACCATGCCCATGATACTGGGGTACTGGGACAT
HKR234345 ARiS085O09 pGCAP10 NM_000561.3  
GACTCTGAGCCCTGCTCGGTTTAGGCCTGTCTGCGGAATCCGCACCAACCAGCACCATGC
HKR277906 ARiS194M18 pGCAP10 NM_000561.3  
GCTCTTATACTCTGAGCCCTGCTCGGTTTAGGCCTGTCTGCGGAATCCGCACCAACCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl