Prev. |  KEGG KO K21456 > 

RIKEN DNA Bank Human Resource - GSS

Gene ID NCBI Gene 2937 |  KEGG hsa:2937
Gene Symbol GSS
Protein Name glutathione synthetase
Synonyms GSHS|HEL-S-64p|HEL-S-88n
Ortholog resources KEGG ortholog (KEGG orthology K21456) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088030 IRAL020B06 pOTB7 BC007927 NM_000178 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053279 ARe33D07 pKA1U5 NM_000178.2  
GCCCCGCCCCCTGAGCCTGGGTAGCGGCGCGAGGGCCGGGAGAACCGTTCGCGGAGGAAA
HKR332580 RBb31H12 pGCAP1 NM_000178.2  
TGCCCCTGAGCCTGGGTAGCGGCGCGAGGGCCGGGAGAACCGTTCGCGGAGGAAAGGCGA
HKR335306 RBb38E10 pGCAP1 NM_000178.2  
TGGAGGCCCCGCCCCCTGAGCCTGGGTAGCGGCGCGAGGGCCGGGAGAACCGTTCGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl