Prev. |  KEGG KO K00383 > 

RIKEN DNA Bank Human Resource - GSR

Gene ID NCBI Gene 2936 |  KEGG hsa:2936
Gene Symbol GSR
Protein Name glutathione-disulfide reductase
Synonyms HEL-75|HEL-S-122m
Ortholog resources KEGG ortholog (KEGG orthology K00383) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031941 IRAK079O05 pCMV-SPORT6 BC035691 NM_000637 Partial
HGY101925 IRAL054N13 pOTB7 BC069244 NM_000637 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR361275 RBd03D03 pGCAP10 NM_000637.2  
TGGAGACTTCCGCGTGCATGGCCCTGCTGCCCCGAGCCCTGAGCGCCGGCGCGGGACCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl